IT-Reviews    

РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ

Рекомендуем: Узнай Китай!
Источник:
Рзаева А.Ш. Впервые было изучено интерлейкина – 8 – 251 ТА среди женщин Азербайджана больными эндометриозом. 50 практически здоровых и 70 женщин больных эндомертиозом находились под нашем наблюдением. Исследование показали что, генетический полиморизм интерлейкина – 8 А/Т 251 играет роль в потогенезе эндометриоза. Статья в формате PDF 236 KB эндометриозинтерлейкина – 8генетический полиморизм

Эндометриоз дисгормоналное, иммунозависимое и генетически обусловленное заболевания с доброкачественным разрастанием ткани, сходной по морфологическому строению и функции с эндометрием, но находящейся за пределами матки [1].

Больные с различными формами этой патологии страдают стойким болевым синдромом, нарушениями менструального цикла, дисфункциональными маточными кровотечениями и подвергаются многократным лечебно - диагностическим выскабливанием матки, оперативным вмешательствам, нередко бесполезным терапевтическим воздействием. [3]

Тазовая боль и вегетативно-сосудистые нарушения заставляют этих женщин обращаться ко многим специалистам, в том числе к психиатрам и психоневрологам.

Частота заболевания у женщин репродуктивного возраста, по данным различных авторов варьирует от 7 до 50 %, причем в последние годы отмечается неуклонный рост данной патологии [9, 10, 11]. Установлено что 30-40 % больных эндометриозом страдают бесплодием и невынашиванием беременности. Не менее чем у 78 % больных, получивших медикаментозную терапию по поводу эндометриоза отмечается персистенция заболевания и его рецидивы. [2]

Не смотря на значительное увеличение числа научных и клинических исследований, посвященных различным аспектам эндометриоза, многие вопросы его этиопатогенеза, диагностики, течение и терапии остаются спорными.

В настоящее время считается доказанным, что выживание и имплантация жизнеспособных фрагментов эндометрия в перитонеальной поверхности обусловлены нарушениям локального иммунного ответа.

У женщин страдающих эндометриозом увеличено содержание перитонеалных макрофагов, усилена их активность и секреция ими различных цитокинов. В последние годы было доказано что в организме женщин больных эндометриозом повышается содержание провоспалительного цитокина интерлейкина - 8 [4, 5, 6,].

Выявлено что за продукцию ИЛ-8 отвечает 13q-21q регион 4-й хромосомы. Генетический полиморфизм ТА в - 251 участке повышает продукцию ИЛ-8 [7, 8].

В Азербайджанской популяции изучению генетической зависимости эндометриоза способствует этническая однородность популяции, высокая частота данного заболевания среди женщин репродуктивного возраста, в связи с чем значительный научный интерес представляют исследования по изучению полиморфизма гена отвечающего за экспрессию интерлейкина - 8.

Целю нашего исследования разработать методы прогнозирования и ранней диагностики эндометриоза по данным полиморфизмов гена ИЛ-8 среди женщин Азербайджанской популяции.

Материалы и методы исследования

Под нашим наблюдением находилась 70 больных страдающих эндометриозом. Диагноз быль подтвержден после операционного вмешательство. Больные были в возрасте от 15 до 56 лет. Длительность заболевания колебалось от нескольких месяцев до 6 лет.

Наряду с общеклиническим обследованием больным было проведено комплексное инструментальное исследование с использованием гистероскопии, гистеросальпингографии, эхографии. Также у всех больных было проведено генетическая тестирование на определения полиморфизма ИЛ-8-251 - АТ.

Контрольную группу составили 50 практически здоровых женщин.

Для выявления полиморфизма ИЛ-8-251-ТА было использовано метод PCR-ARMS.

Участок для амплификации быль выбран на основании материалов предоставленных NCBİ SNP под номером rs4073:

F1, 5′ - GTTATCTAGAAATAAAAAAGCATACAA - 3′;

R1, 5′ - CTCATCTTTTCATTATGTCAGAG - 3′;

F2, 5′ - CATGATAGCATCTGTAATTAACTG - 3′;

R2, 5′ - CACAATTTGGTGAATTATCAA - 3′.

Для проведения реакции были использованы следующие реагенты:

DNT-5μl; Buffer 2,5μ; MgCl2-1,75μl; dNTP-0,5μl, из каждого примера 10 pmol; Taq A - 0,2μl.

Реакция PCR было проведено по следующему протоколу:

94 ºC - 5 мин - 1 цикл, 94 ºC - 30 мин, 54 ºC - 30 с, 72 ºC - 30 с, 35 цикл и 72 ºC - 7 мин - 1 цикл.

Полученные материалы были визуализированы после электрофореза в 2 % - ном агорозном геле.

Результаты исследования

Генотипы по полиморфизму ИЛ-8 ТА представлен в табл. 1.

У женщин с эндометриозом генотип ТТ составила 41,4 %. В контрольной группе генотип АА составило 50 % в то время как этот генотип в основной группе составило 21,4 %.

Таблица 1

Распостраненность генотипов ИЛ-8 ТА среди практически здоровых женщин
и больных эндометриозом 

Генотипы

Контроль (n = 50)

Эндометриоз (n = 70)

TT

7 (14 %)

29 (41,4 %)

TA

18 (36 %)

26 (37,2 %)

AA

25 (50 %)

15 (21,4 %)

Популяция было в пределах равновесия по закону Харди - Вайнберга. p > 0,05

Также эти группы отличались друг от друга по аллелным показателям.

Так как, у женщин страдающих эндометриозом частота алела Т составило 60 %. Этот показатель был выше, чем в контрольной группе. В контрольной группе частота аллела А составило 68 % в то время как частота алела Т было всего 32 %.

Нами было выявлено связь между генотипом Т/Т и эндометриозом. Частота генотипа Т/Т у женщин страдающих эндометриозом было в два раза выше чем в контрольной группе.

Генетическое тестирования женщин повышенного риска развитие эндометриоза представляет важный как теоретический, так и практический интерес. Выявления полиморфизма гена ИЛ-8 позволит на доклиническом этапе определить возможный риск развитие эндометриоза и заблаговременно начать индивидуальную профилактику этого заболевания.

Таблица 2

Частота аллелов по полиморфизму ИЛ-8 - 251 АТ среди женщин
с эндометриозом и в контрольной группе 

Аллели

Контроль (n = 100)

Эндометриоз (n = 140)

T

32 (32 %)

84 (60 %)

A

68 (68 %)

56 (40 %)

 Список литературы

  1. Кулаков В.И., Андреева Е.Н. Эндометриозы. - М.: Медицина, 2006. - 410 с.
  2. Поморцев А.В., Гудков В.Г., Дегтярев А.М. Гормональный профиль больных наружным генитальным эндометриозом в различные фазы менструального цикла // Акуш. и гин. - 2002. - №1 - С. 35-42.
  3. Сидорова И.С., Коган К.А. Новый взгляд на природу эндометриоза // Акуш. и гин. - 2002. - № 3. - С. 32-37.
  4. Halme J., Becker S., Haskill S. Altered maturation and functional of peritoneal macrophages: possible role in pathogenesis of endometriosis // J. Obstet.Gynecol. - 1987. - P. 783-789.
  5. Hill J. A. et al. Effects of soluble products of activated macrophages on human sperm motion parameters // J. Fertil. Steril. - 1987. - №47. - P. 460-465.
  6. Halme J. Release of tumor necrosis fector by human peritoneal macrophages in vivo and in vitro // J. Obst. And Gynecol. - 1989. -№161. - P. 1718-1725.
  7. Hull J. Thomson A, Kviatkovski D. Assocation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families // J. Thorax. - 2000. - v. 55. - P. 1023-1027.
  8. Junko Fujihara, kuninori Shiwaku, Toshihiro Yasuda et all. Variation of interleukin -8 - 251 AT polymorphism in worldwide populations and intra-ethnic differences in Japanese populations. // Clinica Chimica Acta 337. - 2007. - P. 79-82.
  9. Karen Kinkel, Kathrin A. Frei. Diagnosis of endometriosis with imaging: a review. Eur. Radiol. - 2006. internet.
  10. Schindler A.E. Pathophysiology, diaqnosis and treatment of endometriosis // Minevra Ginecol. - P. 419-435.
  11. Vigano P, Parazzini F, Somigliana E. // Endometriosis: epidemiology and aetiological factors // J. Obstet. And Gynaecol. - 2004. - №18. - P. 177-200.



Отзывы (через Facebook):

Оставить отзыв с помощью аккаунта FaceBook:

ВЛИЯНИЕ БИОПРЕПАРАТОВ НА ФОТОСИНТЕТИЧЕСКИЙ ПОТЕНЦИАЛ И ПРОДУКТИВНОСТЬ РАННИХ ГИБРИДОВ ОГУРЦА В ПЛЕНОЧНОЙ ТЕПЛИЦЕ

Установлено, что применение биопрепаратов биогумус, гуми и альбит при замачивании семян и некорневой подкормке раннеспелых гибридов огурца в пленочной теплице, положительно влияют на энергию прорастания и всхожесть семян, ускоряют рост и развитие растений огурца, сокращают межфазный период на 3- 4 дня, вегетационный период, на 5-6 дней. Благоприятно влияют на водный режим растений, увеличение ассимиляционной поверхности, фотосинтетический потенциал и урожайность. Наиболее эффективное действие оказывали биопрепараты биогумус и гумми на гибридах, отечественной селекции Арина и голландской Машенька. ...

18 04 2021 12:52:29

МОДУЛЬНЫЕ ТЕХНОЛОГИИ РЕАЛИЗАЦИИ УЧЕБНОГО ПРОЦЕССА

Статья в формате PDF 169 KB...

15 04 2021 5:34:38

ПРИНЦИПЫ МЕДИКАМЕНТОЗНОЙ КОРРЕКЦИИ МЕТАБОЛИЧЕСКИХ РАССТРОЙСТВ ПРИ ИШЕМИЧЕСКОМ ПОВРЕЖДЕНИИ МИОКАРДА

В опытах на беспородных белых крысах с экспериментальной ишемией миокарда в динамике наблюдений отмечено снижение уровня А Т Ф и креатинфосфата в гомогенатах миокарда на фоне подавления активности сукцинатдегидрогеназы, лактатдегидрогеназы, аспартатаминотрансферазы. Достигнуты положительные метаболические эффекты при введении ишемизированным животным неотона – донатора макроэргических связей и оказывающего активирующий эффект на ферменты гликолиза и цикла трикарбоновых кислот в динамике патологии. ...

10 04 2021 7:48:53

ФОРМАЛИЗАЦИЯ ВЛИЯНИЯ ВНЕШНИХ СВЯЗЕЙ НА КАЧЕСТВО ОБРАЗОВАНИЯ В ФИЛИАЛЕ ВУЗА

Построена математическая модель системы управления качеством образования филиала В У За с учетом влияния внешних информационных связей, проведена оценка критерия качества и улучшения внешних связей вследствие внедрения информационной системы. ...

30 03 2021 22:41:10

ВОЗМОЖНЫЕ НАПРАВЛЕНИЯ ПСИХОЛОГИЧЕСКОЙ АДАПТАЦИИ ЛИЦ ПОЖИЛОГО ВОЗРАСТА

Изменяющиеся условия жизни приводят к изменению поведения и психологии наиболее уязвимых групп населения, к которым относятся пожилые и старые люди. Наиболее значимыми считаются адаптивные защитные реакции, такие как озабоченность, тревожность, депрессия. Работа поддержана и финансируется Министерством образования и науки. ...

25 03 2021 0:36:32

СЕМЬЯ УЛЬЯНОВЫХ И БЛАГОТВОРИТЕЛЬНОСТЬ

Статья в формате PDF 140 KB...

24 03 2021 22:30:21

АНДРАГОГИЧЕСКИЕ ПРОБЛЕМЫ В ПРОФЕССИОНАЛЬНОЙ ПОДГОТОВКЕ МЕДИЦИНСКИХ РАБОТНИКОВ

Обучение взрослых дипломированных специалистов существенно отличается от обучения студентов. Если на додипломном уровне приемлема педагогическая модель обучения с доминантой обучающего, то на этапе же последипломного образования необходимо руководствоваться продуктивной андрагогической моделью обучения. Её главный постулат: обучающийся – ведущее звено в процессе образования. Исходя из этого, в течение ряд лет мы используем методику психологического типирования личности американского исследователя Д. Кейрси. И на основании выявления уровней подготовки, психофизиологических и личностных особенностей обучающихся практикуем деловые игры, мастер-классы, создание взрослыми обучающимися порт-фолио непосредственно на рабочем месте. Результаты положительные. ...

12 03 2021 17:45:55

МНОГОМЕРНЫЙ ОБРАЗ ЧЕЛОВЕКА В КОНТЕКСТЕ КАЗАХСКОЙ ТРАДИЦИИ

В данной статье выделены основные подходы к проблеме человека, сложившиеся в истории казахской традиции и современной казахской философской мысли. По мнению автора, в объяснении феномена человека казахской традицией можно найти ряд толкований, пояснений, отражающих особое внимание к человеку, его духовному миру, самоценности, достоинству, чести. Именно на этой основе казахская национальная традиция получает возможность сосредоточиться на рассмотрении своего видения проблемы отношения человека и мира. ...

11 03 2021 18:31:59

О НАХОЖДЕНИИ ОБЪЕМОВ ТЕЛ ВРАЩЕНИЯ

Статья в формате PDF 271 KB...

10 03 2021 13:21:15

ДИСКОЛЕТ И ЕГО АВТОМОДЕЛЬНОСТЬ

Измерена подъемная сила, создаваемая скошенным экранированным кольцевым крылом. Показано, что экспериментальные результаты удовлетворяют свойству автомодельности. ...

09 03 2021 11:33:39

ИЗМЕНЕНИЕ КАПСУЛЫ СЕЛЕЗЕНКИ В УСЛОВИЯХ ХРОНИЧЕСКОЙ АЛКОГОЛЬНОЙ ИНТОКСИКАЦИИ

Статья посвящена актуальной проблеме – влиянию хронической алкогольной интоксикации на изменение структуры капсулы селезенки в раннем постнатальном онтогенезе. Дана сравнительная гистологическая характеристика капсулы с учетом зависимости изменений от различной концентрации потребляемого алкоголя. ...

08 03 2021 19:41:15

К ВОПРОСУ О ДОСТУПНОСТИ ЖИЛЬЯ В ГОРОДЕ ВЛАДИВОСТОКЕ

Статья в формате PDF 100 KB...

02 03 2021 16:21:23

ВОДА И ЗДОРОВЬЕ

Статья в формате PDF 263 KB...

01 03 2021 10:25:45

МАТЕМАТИЧЕСКИЕ МОДЕЛИ В ЗДРАВООХРАНЕНИИ

Статья в формате PDF 103 KB...

21 02 2021 23:24:20

ХАРАКТЕРИСТИКА ОВЦЕВОДСТВА РЕСПУБЛИКИ ТЫВА ПО ПОРОДНОМУ СОСТАВУ И ЗОНАЛЬНО-ТЕРРИТОРИАЛЬНОМУ РАЗМЕЩЕНИЮ ПОГОЛОВЬЯ ОВЕЦ

Представлены породный состав, структура и концентрация поголовья овец в разрезе природно-экономических зон Республики Тыва. ...

20 02 2021 4:25:42

ИЗУЧЕНИЕ УСЛОВИЙ ПОЛУЧЕНИЯ ФИЦИН-СОДЕРЖАЩЕГО СЫРЬЯ

Статья в формате PDF 124 KB...

19 02 2021 15:15:37

ЯЗЫКОВАЯ СПЕЦИФИКА АНГЛО- И РУССКОЯЗЫЧНЫХ БЛОГОВ

Статья в формате PDF 261 KB...

14 02 2021 22:48:27

РЕЗУЛЬТАТЫ ФАРМАКОЛОГИЧЕСКОГО ИССЛЕДОВАНИЯ НОВОГО СИНТЕТИЧЕСКОГО БИОЛОГИЧЕСКИ АКТИВНОГО ВЕЩЕСТВА «4-АММОНИЙ ПИРИДИН ТЕТРАХЛОРПАЛЛАДИТ»

Химиотерапевтические средства в комплексе с хирургическими операциями широко используются для лечения онкологических больных. Несмотря на то, что арсенал этих препаратов широко представлен, все эти препараты обладают высокой токсичностью. Результаты цитогенетических исследований, проводимых на семенах пшеницы безостая – 1 показали, что 0,01; 0,02 и 0,05 % растворы исследуемого вещества не обладают цитотоксичностью, и лишь в разведении 0,1 % обнаруживает слабое цитотоксическое действие. Методом биотеста было выявлено, что при внутрибрюшинном введении белым мышам 1 мл раствора 4-аммоний пиридин тетрахлорпалладита исследуемое вещество обнаруживает высокую токсичность, которая усиливается со времени, начиная с момента введения, и зависит от концентрации введенного раствора. ...

10 02 2021 7:53:57

НЕКОТОРЫЕ АСПЕКТЫ НАРКОПРЕСТУПНОСТИ

Статья в формате PDF 251 KB...

08 02 2021 20:45:21

КОМПЕТЕНТНОСТИ – РЕЗУЛЬТАТИВНО-ЦЕЛЕВАЯ ОСНОВА ОБУЧЕНИЯ БЕЗОПАСНОСТИ ЖИЗНЕДЕЯТЕЛЬНОСТИ В КОНТЕКСТЕ ДЕЯТЕЛЬНОСТНОГО ПОДХОДА

Обобщаются понятия «компетентность». Формулируются компетентности, необходимые для решения проблем безопасности жизнедеятельности в практической работе инженера. Предлагается направление целевого развития компетентностей выпускника технического вуза в процессе его обучения. ...

02 02 2021 15:50:52

БИОХИМИЧЕСКИЙ АНАЛИЗ КРОВИ КРЫС ПРИ ХРОНИЧЕСКОМ ОТРАВЛЕНИИ СОЛЯМИ МОЛИБДЕНА И ХРОМА

При хроническом отравлении солями молибдена и хрома определены функциональные нарушения у экспериментальных животных. Изменения в плазме крови выявили нарушения желудочно-кишечного тракта, печени, почек, сердечной мышцы крыс. ...

29 01 2021 6:44:26

О НАЧАЛЬНОЙ СТАДИИ ПОЧВООБРАЗОВАНИЯ НА ПОСТТЕХНОГЕННЫХ ЛАНДШАФТАХ ЗАПАДНОЙ ЯКУТИИ

Получены сведения о начальных стадиях развития. Согласно профильно-генетической классификации почв техногенных ландшафтов [5] морфологически выделены элювиоземы инициальные, эмбриоземы инициальные и органо-аккумулятивные. Экспериментально показано, что выделение этих типов почв вследствие низкой скорости почвообразования пока возможно только по почвенно-биологическими показателями. Установлено, что микробное сообщество молодых почв на отвалах Мирнинского Г О К имеет характерные черты для начальной стадии почвообразования: более высокую в сравнение зональной почвой численность; низкую активность утилизации целлюлозы; низкую инвентарную. Последнее свидетельствует о низкой скорости формирования органо-минерального комплекса почвы. Выявлено, возможности дифференциации типов молодых техногенных ландшафтов по способу субстратов поддерживать начальный рост тест растений. ...

25 01 2021 18:10:52

АНАЛЬГЕТИЧЕСКАЯ АКТИВНОСТЬ ОТВАРОВ КОРЫ И ОДНОЛЕТНИХ ПОБЕГОВ ИВЫ БЕЛОЙ

Объект исследования – ива белая, которая распространена практически по всей территории Европейской части России. За рубежом препараты и Б А Д из различных видов ивы активно применяются при заболеваниях суставов. В соответствии с Руководством по доклиническому изучению новых фармакологических веществ ( Р. У. Хабриев, 2005) оценивали эффективность анальгетического действия и токсичность отваров коры и однолетних побегов ивы белой на мышах. Отвары коры и побегов ивы относятся к классу малоопасные соединения и проявляют выраженную анальгетическую активность, сопоставимую с препаратом сравнения анальгином (метамизол). ...

17 01 2021 3:25:15

ВИНОКУРОВ ИВАН НИКОЛАЕВИЧ

Статья в формате PDF 285 KB...

14 01 2021 20:12:49

УНИВЕРСАЛЬНЫЙ ХАРАКТЕР РЕКУРРЕНТНЫХ ЗАВИСИМОСТЕЙ ФИЗИКО-ХИМИЧЕСКИХ СВОЙСТВ ОРГАНИЧЕСКИХ СОЕДИНЕНИЙ

Уникальные возможности линейных рекуррентных уравнений первого порядка А(n+1) = aA(n) + b позволяют характеризовать закономерности изменения различных свойств органических соединений ( А) не только в пределах локальных групп гомологов, но и одновременно всех рядов с одинаковыми гомологическими разностями. Более того, рекуррентные соотношения применимы к функциям не только целочисленных (число атомов углерода в молекуле), но и равноотстоящих значений аргументов A(x+Δx) = aA(x) + b, (Δx = const). Этот способ аппроксимации проиллюстрирован на примерах температурных зависимостей растворимости различных веществ в воде и даже времен релаксации в высокочастотных полях. ...

11 01 2021 18:26:47

СТАТИСТИЧЕСКОЕ МОДЕЛИРОВАНИЕ ФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ ПРИ ХРОНИЧЕСКОЙ СЕРДЕЧНОЙ НЕДОСТАТОЧНОСТИ У БОЛЬНЫХ ИШЕМИЧЕСКОЙ БОЛЕЗНЬЮ СЕРДЦА

В статье описываются математические модели в виде уравнения регрессии, которое позволяет по клиническим признакам хронической сердечной недостаточности со статистической достоверностью предсказать результаты 6-минутного теста. ...

05 01 2021 19:34:27

«ПОСЛЕДСТВИЯ МОДЕРНОСТИ» В ФИЛОСОФИИ А. ГИДДЕНСА

Статья в формате PDF 125 KB...

24 12 2020 19:58:31

КОНТЕЙНЕРЫ В МЕТОДОЛОГИИ ПРОГРАММИРОВАНИЯ

Статья в формате PDF 101 KB...

14 12 2020 15:36:39

КРАСОТА КАК СОЦИАЛЬНЫЙ КОНСТРУКТ

Статья в формате PDF 339 KB...

10 12 2020 15:23:14

НЕОПРЕДЕЛЕННОСТЬ ВИДА 0/0

Статья в формате PDF 459 KB...

09 12 2020 1:22:13

АРХЕТИПИЧЕСКИЕ ОСНОВАНИЯ БЫТИЯ НООСФЕРЫ

Статья в формате PDF 110 KB...

28 11 2020 17:39:55

Еще:
Обзоры -1 :: Обзоры -2 :: Обзоры -3 :: Обзоры -4 :: Обзоры -5 :: Обзоры -6 :: Обзоры -7 :: Обзоры -8 :: Обзоры -9 :: Обзоры -10 :: Обзоры -11 ::

Последовательность подготовки научной работы может быть такой:

Выбор темы. Это важный этап. Во-первых, тема должна быть интересна не только вам, но и большинству слушателей, которым вы будете её докладывать, чтобы вы видели заинтересованность в их глазах, а не откровенную скуку.

Выбор целей и задач своей научной работы. То есть, нужно сузить тему. Например, тема: «Грудное вскармливание», сужение темы: «Грудное вскармливание среди студенток нашего ВУЗа». И если общая тема мало кому интересна, то суженная до рамок собственного института или университета, она становится интересной практически для всех слушателей. Целью может стать: «Содействие оптимальным условиям вскармливания грудью детей студентов нашего ВУЗа», а задачей — доказать, что специальные условия, созданные для кормящих студенток, не помешают их успеваемости, но уменьшат количество пропусков, академических отпусков и способствуют выращиванию здоровых детей — нашего будущего. Понятно, что эта тема подходит для студентов медицинских и педагогических ВУЗов, но и в других учебных учреждениях можно найти темы, интересные всем.

Разработать методы исследования и сбора информации. В случае с естественным вскармливанием, скорее всего, это будет анкетирование студенток, имеющих детей.

Систематизировать материал и подготовить презентацию.

Подготовиться к выступлению.

Выступить и получить: награду, удовольствие и опыт, чтобы в следующем году выступить ещё лучше и сорвать шквал аплодисментов, стать узнаваемым, а значит — более конкурентоспособным!