IT-Reviews    

РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ

Рзаева А.Ш. Впервые было изучено интерлейкина – 8 – 251 ТА среди женщин Азербайджана больными эндометриозом. 50 практически здоровых и 70 женщин больных эндомертиозом находились под нашем наблюдением. Исследование показали что, генетический полиморизм интерлейкина – 8 А/Т 251 играет роль в потогенезе эндометриоза. Статья в формате PDF 236 KB эндометриозинтерлейкина – 8генетический полиморизм

Эндометриоз дисгормоналное, иммунозависимое и генетически обусловленное заболевания с доброкачественным разрастанием ткани, сходной по морфологическому строению и функции с эндометрием, но находящейся за пределами матки [1].

Больные с различными формами этой патологии страдают стойким болевым синдромом, нарушениями менструального цикла, дисфункциональными маточными кровотечениями и подвергаются многократным лечебно - диагностическим выскабливанием матки, оперативным вмешательствам, нередко бесполезным терапевтическим воздействием. [3]

Тазовая боль и вегетативно-сосудистые нарушения заставляют этих женщин обращаться ко многим специалистам, в том числе к психиатрам и психоневрологам.

Частота заболевания у женщин репродуктивного возраста, по данным различных авторов варьирует от 7 до 50 %, причем в последние годы отмечается неуклонный рост данной патологии [9, 10, 11]. Установлено что 30-40 % больных эндометриозом страдают бесплодием и невынашиванием беременности. Не менее чем у 78 % больных, получивших медикаментозную терапию по поводу эндометриоза отмечается персистенция заболевания и его рецидивы. [2]

Не смотря на значительное увеличение числа научных и клинических исследований, посвященных различным аспектам эндометриоза, многие вопросы его этиопатогенеза, диагностики, течение и терапии остаются спорными.

В настоящее время считается доказанным, что выживание и имплантация жизнеспособных фрагментов эндометрия в перитонеальной поверхности обусловлены нарушениям локального иммунного ответа.

У женщин страдающих эндометриозом увеличено содержание перитонеалных макрофагов, усилена их активность и секреция ими различных цитокинов. В последние годы было доказано что в организме женщин больных эндометриозом повышается содержание провоспалительного цитокина интерлейкина - 8 [4, 5, 6,].

Выявлено что за продукцию ИЛ-8 отвечает 13q-21q регион 4-й хромосомы. Генетический полиморфизм ТА в - 251 участке повышает продукцию ИЛ-8 [7, 8].

В Азербайджанской популяции изучению генетической зависимости эндометриоза способствует этническая однородность популяции, высокая частота данного заболевания среди женщин репродуктивного возраста, в связи с чем значительный научный интерес представляют исследования по изучению полиморфизма гена отвечающего за экспрессию интерлейкина - 8.

Целю нашего исследования разработать методы прогнозирования и ранней диагностики эндометриоза по данным полиморфизмов гена ИЛ-8 среди женщин Азербайджанской популяции.

Материалы и методы исследования

Под нашим наблюдением находилась 70 больных страдающих эндометриозом. Диагноз быль подтвержден после операционного вмешательство. Больные были в возрасте от 15 до 56 лет. Длительность заболевания колебалось от нескольких месяцев до 6 лет.

Наряду с общеклиническим обследованием больным было проведено комплексное инструментальное исследование с использованием гистероскопии, гистеросальпингографии, эхографии. Также у всех больных было проведено генетическая тестирование на определения полиморфизма ИЛ-8-251 - АТ.

Контрольную группу составили 50 практически здоровых женщин.

Для выявления полиморфизма ИЛ-8-251-ТА было использовано метод PCR-ARMS.

Участок для амплификации быль выбран на основании материалов предоставленных NCBİ SNP под номером rs4073:

F1, 5′ - GTTATCTAGAAATAAAAAAGCATACAA - 3′;

R1, 5′ - CTCATCTTTTCATTATGTCAGAG - 3′;

F2, 5′ - CATGATAGCATCTGTAATTAACTG - 3′;

R2, 5′ - CACAATTTGGTGAATTATCAA - 3′.

Для проведения реакции были использованы следующие реагенты:

DNT-5μl; Buffer 2,5μ; MgCl2-1,75μl; dNTP-0,5μl, из каждого примера 10 pmol; Taq A - 0,2μl.

Реакция PCR было проведено по следующему протоколу:

94 ºC - 5 мин - 1 цикл, 94 ºC - 30 мин, 54 ºC - 30 с, 72 ºC - 30 с, 35 цикл и 72 ºC - 7 мин - 1 цикл.

Полученные материалы были визуализированы после электрофореза в 2 % - ном агорозном геле.

Результаты исследования

Генотипы по полиморфизму ИЛ-8 ТА представлен в табл. 1.

У женщин с эндометриозом генотип ТТ составила 41,4 %. В контрольной группе генотип АА составило 50 % в то время как этот генотип в основной группе составило 21,4 %.

Таблица 1

Распостраненность генотипов ИЛ-8 ТА среди практически здоровых женщин
и больных эндометриозом 

Генотипы

Контроль (n = 50)

Эндометриоз (n = 70)

TT

7 (14 %)

29 (41,4 %)

TA

18 (36 %)

26 (37,2 %)

AA

25 (50 %)

15 (21,4 %)

Популяция было в пределах равновесия по закону Харди - Вайнберга. p > 0,05

Также эти группы отличались друг от друга по аллелным показателям.

Так как, у женщин страдающих эндометриозом частота алела Т составило 60 %. Этот показатель был выше, чем в контрольной группе. В контрольной группе частота аллела А составило 68 % в то время как частота алела Т было всего 32 %.

Нами было выявлено связь между генотипом Т/Т и эндометриозом. Частота генотипа Т/Т у женщин страдающих эндометриозом было в два раза выше чем в контрольной группе.

Генетическое тестирования женщин повышенного риска развитие эндометриоза представляет важный как теоретический, так и практический интерес. Выявления полиморфизма гена ИЛ-8 позволит на доклиническом этапе определить возможный риск развитие эндометриоза и заблаговременно начать индивидуальную профилактику этого заболевания.

Таблица 2

Частота аллелов по полиморфизму ИЛ-8 - 251 АТ среди женщин
с эндометриозом и в контрольной группе 

Аллели

Контроль (n = 100)

Эндометриоз (n = 140)

T

32 (32 %)

84 (60 %)

A

68 (68 %)

56 (40 %)

 Список литературы

  1. Кулаков В.И., Андреева Е.Н. Эндометриозы. - М.: Медицина, 2006. - 410 с.
  2. Поморцев А.В., Гудков В.Г., Дегтярев А.М. Гормональный профиль больных наружным генитальным эндометриозом в различные фазы менструального цикла // Акуш. и гин. - 2002. - №1 - С. 35-42.
  3. Сидорова И.С., Коган К.А. Новый взгляд на природу эндометриоза // Акуш. и гин. - 2002. - № 3. - С. 32-37.
  4. Halme J., Becker S., Haskill S. Altered maturation and functional of peritoneal macrophages: possible role in pathogenesis of endometriosis // J. Obstet.Gynecol. - 1987. - P. 783-789.
  5. Hill J. A. et al. Effects of soluble products of activated macrophages on human sperm motion parameters // J. Fertil. Steril. - 1987. - №47. - P. 460-465.
  6. Halme J. Release of tumor necrosis fector by human peritoneal macrophages in vivo and in vitro // J. Obst. And Gynecol. - 1989. -№161. - P. 1718-1725.
  7. Hull J. Thomson A, Kviatkovski D. Assocation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families // J. Thorax. - 2000. - v. 55. - P. 1023-1027.
  8. Junko Fujihara, kuninori Shiwaku, Toshihiro Yasuda et all. Variation of interleukin -8 - 251 AT polymorphism in worldwide populations and intra-ethnic differences in Japanese populations. // Clinica Chimica Acta 337. - 2007. - P. 79-82.
  9. Karen Kinkel, Kathrin A. Frei. Diagnosis of endometriosis with imaging: a review. Eur. Radiol. - 2006. internet.
  10. Schindler A.E. Pathophysiology, diaqnosis and treatment of endometriosis // Minevra Ginecol. - P. 419-435.
  11. Vigano P, Parazzini F, Somigliana E. // Endometriosis: epidemiology and aetiological factors // J. Obstet. And Gynaecol. - 2004. - №18. - P. 177-200.



c78089d0

Отзывы (через Facebook):

Оставить отзыв с помощью аккаунта FaceBook:

ПРЕДСТАВЛЕНИЕ ФУНКЦИИ РАЗЛИЧНЫМИ РЯДАМИ ФУРЬЕ

Статья в формате PDF 648 KB...

04 06 2020 8:56:58

Некоторые вопросы занятости населения в крае

Статья в формате PDF 118 KB...

03 06 2020 20:19:29

ГАСТРОЭЗОФАГЕАЛЬНАЯ РЕФЛЮКСНАЯ БОЛЕЗНЬ И ПИЩЕВОД БАРРЕТТА: КЛИНИКО-ИММУНОЛОГИЧЕСКИЕ ПАРАЛЛЕЛИ

Цель исследования - изучение особенностей клеточного звена иммунитета и содержания цитокинов в сыворотке крови у пациентов с гастроэзофагеальной рефлюксной болезнью и пищеводом Барретта. Обследованы 70 пациентов с эрозивной формой гастроэзофагеальной рефлюксной болезни и 42 пациента с пищеводом Барретта. Применены клинические, эндоскопические, морфологические, иммунологические методы исследования. Выявлены различия в показателях клеточного звена иммунитета и содержания в сыворотке крови интерлейкина-4, интерлейкина-8, интерлейкина-10, фактора некроза опухолей-, интерферона- у больных гастроэзофагеальной рефлюксной болезнью в динамике лечения и у пациентов с пищеводом Барретта. ...

01 06 2020 20:12:55

МЕСТО ТОРГОВОЙ СФЕРЫ ЭКОНОМИКИ В СИСТЕМЕ РЫНОЧНОГО ХОЗЯЙСТВОВАНИЯ

В данной работе авторами выдвигается и обосновывается тезис о том, что торгово-коммерческая деятельность является определяющим фактором в системе рыночных отношений. ...

19 05 2020 20:29:18

ВИНДЖАММЕРЫ – «ВЫЖИМАТЕЛИ ВЕТРА»

Статья в формате PDF 412 KB...

16 05 2020 14:18:18

ПРОБЛЕМА ПОЛУЧЕНИЯ ВЫСОКОКАЧЕСТВЕННОГО ФАРФОРА

Статья в формате PDF 113 KB...

11 05 2020 19:17:38

Влияние фонового квч излучения на биологические объекты и циркадные ритмы больных гипертонической болезнью

Ф Р И-терапия ( С Е М-терапия) основана на использовании материалов с управляемой энергетической структурой (CEM – Controlled Energy Material). Излучателем сверхслабых излучений К В Ч-диапазона при интенсивности 10–16–10–20  Вт/см2 является диод Ганна. Представлена оценка влияния фонового миллиметрового излучения на стафилококки, на нативную кровь, а также на вегетативный статус пациента гипертонической болезнью в сравнительном аспекте по графикам циркадных ритмов пульса при приеме: препаратов, не влияющих на ритм сердца; структурированной воды, активированной посредством аппарата «Cem-Tech»; полной дозы препарата лодоза; воды, содержащей информацию о порошкообразном лодозе. Рассмотренная индивидуальная динамика параметров ритмограммы, вычисленных на основе регистрации 500 межпульсовых интервалов, оценивалась с вычислением показателей уровня статистической значимости различий. Показано, что прием препарата Лодоз и воды содержащей информацию о препарате Лодоз сопровождается сходными изменениями, как частоты пульса, так и внутренней структуры информационного паттерна HRV. Динамика параметров ритма сердца свидетельствует о мобилизации холинергических механизмов регулирования. ...

09 05 2020 23:31:39

КОНТАКТНАЯ АКТИВАЦИЯ ВЕНОЗНОЙ КРОВИ

Статья в формате PDF 119 KB...

06 05 2020 10:18:54

ГЕОЭКОЛОГИЧЕСКИЕ ПРОБЛЕМЫ СОВРЕМЕННОЙ РАКЕТНО-КОСМИЧЕСКОЙ ДЕЯТЕЛЬНОСТИ

К настоящему времени геофизика накопила о магнетизме Земли огромную информацию, большая часть которой получена в новейший период исследований космического пространства путём непосредственных инструментальных исследований с помощью космических летательных аппаратов, но построить на традиционных теоретических основаниях общепризнанную теорию о происхождении магнетизма Земли пока не удавалось никому [1]. Учитывая продуктивность магнитодинамического взгляда ряда фундаментальных проблем физики и многочисленных технических задач [2], можно надеяться на аналогичную продуктивность при рассмотрении некоторых из многочисленных аспектов фундаментальной проблемы стационарного геомагнетизма, среди которых первичной представляется его происхождение. ...

05 05 2020 0:48:26

НЕКОТОРЫЕ АСПЕКТЫ СОВРЕМЕННОЙ КВАНТОВОЙ ХИМИИ

Статья в формате PDF 95 KB...

20 04 2020 22:22:50

ВСЕРОССИЙСКАЯ КОНФЕРЕНЦИЯ «ПРОБЛЕМЫ МОРФОРОЛИИ»

Статья в формате PDF 86 KB...

17 04 2020 4:24:21

МНОГОМЕРНЫЙ ОБРАЗ ЧЕЛОВЕКА В КОНТЕКСТЕ КАЗАХСКОЙ ТРАДИЦИИ

В данной статье выделены основные подходы к проблеме человека, сложившиеся в истории казахской традиции и современной казахской философской мысли. По мнению автора, в объяснении феномена человека казахской традицией можно найти ряд толкований, пояснений, отражающих особое внимание к человеку, его духовному миру, самоценности, достоинству, чести. Именно на этой основе казахская национальная традиция получает возможность сосредоточиться на рассмотрении своего видения проблемы отношения человека и мира. ...

10 04 2020 17:53:48

КЛЕТКИ СТЕКЛОВИДНОГО ТЕЛА ГЛАЗА ЧЕЛОВЕКА

Статья в формате PDF 140 KB...

06 04 2020 23:29:39

СИСТЕМА ЦЕННОСТЕЙ СОВРЕМЕННОГО УЧИТЕЛЯ

Статья в формате PDF 182 KB...

03 04 2020 21:36:30

МАТЕМАТИЧЕСКАЯ МОДЕЛЬ УРОВНЯ ПСИХИЧЕСКОЙ РЕАКЦИИ ЧЕЛОВЕКА И ЕЁ ИССЛЕДОВАНИЕ

В статье описывается математическая модель, связывающая уровень психической реакции с личностными характеристиками человека и с силой информационного воздействия на него. Исследуются условия устойчивости модели методами теории автоматического управления. ...

29 03 2020 15:30:51

КРИТЕРИИ ОТВЕТСТВЕННОГО ОТЦОВСТВА

Статья в формате PDF 116 KB...

23 03 2020 0:37:40

МЕТОДОЛОГИЯ ПРОГНОЗИРОВАНИЯ ЭКОНОМИЧЕСКОГО ПОТЕНЦИАЛА РЕГИОНА

Статья посвящена авторской методологии прогнозирования экономического потенциала региона на примере Краснодарского края. В ходе научных исследований был разработан оригинальный математический аппарат, позволяющий оценить основные экономические показатели региона, который применяется для социально-экономического прогноза региона на текущий и перспективный периоды. Описательная часть содержит основные подходы и этапы эффективного экономического прогнозирования региона. ...

21 03 2020 4:17:19

ЭНЕРГОСБЕРЕЖЕНИЕ ПРИ АКТИВАЦИИ ВОДЫ

Статья в формате PDF 91 KB...

15 03 2020 11:35:45

Заживление суставного хряща при имплантации минерального компонента костного матрикса

В эксперименте на половозрелых крысах Wistar исследованы особенности регенерации суставного хряща коленного сустава после имплантации в зону повреждения гранулированного минерального компонента костного матрикса ( М К К М), полученного по оригинальной технологии. Установлено, что М К К М имеет упорядоченную высокопористую структуру, близкую к естественной архитектонике костного матрикса и химический состав, соответствующий минеральному составу кости. М К К М обладает выраженными хондро- и остеиндуктивными свойствами, обеспечивает пролонгированную активизацию репаративного процесса, ускоренное органотипическое ремоделирование и восстановление поврежденного суставного хряща. ...

14 03 2020 15:14:21

СТОЛЯРОВ СТАНИСЛАВ ПЕТРОВИЧ

Статья в формате PDF 225 KB...

11 03 2020 15:48:30

ЩИТОВИДНАЯ ЖЕЛЕЗА: ПОКАЗАТЕЛЬ ПЛОЩАДИ КОНТАКТА ЭПИТЕЛИЙ-СТРОМА

Разработан новый морфометрический показатель площади контакта эпителия и стромы. Показатель использовался автором при многолетних исследованиях морфофункционального состояния щитовидной железы у женщин и в эксперименте. ...

09 03 2020 0:10:48

ИСПОЛЬЗОВАНИЕ МЕТОДА ПРОЕКТОВ В ЛИЦЕЕ ПРИ ВУЗЕ

Статья в формате PDF 97 KB...

03 03 2020 2:55:19

ИЗМЕНЕНИЯ ФИЗИОЛОГИЧЕСКИХ ПОКАЗАТЕЛЕЙ У ШКОЛЬНИКОВ С РАЗЛИЧНОЙ ЭМОЦИОНАЛЬНОЙ УСТОЙЧИВОСТЬЮ В ПЕРИОД ИХ РАБОТЫ ЗА КОМПЬЮТЕРОМ

Исследованы изменения физиологических показателей школьников в условиях их работы за компьютером в течение учебного года. Дан сравнительный анализ изменений физиологических показателей школьников, отличающихся эмоциональной устойчивостью. Получены результаты, свидетельствующие о неблагоприятном влиянии условий работы за компьютером на школьников младших классов осенью и весной. ...

26 02 2020 19:13:35

Краснощекова Галина Алексеевна

Статья в формате PDF 177 KB...

25 02 2020 11:33:44

ВОЗМОЖНЫЕ ПУТИ ПРОФИЛАКТИКИ КАРИЕСА ЗУБОВ ПРИ ОРТОДОНТИЧЕСКОМ ЛЕЧЕНИИ

Наши исследования показали, что эффективность профилактики кариеса зубов значительно снижается на фоне вторичных иммунодефицитных состояний ( И Д С), вызванных ортодонтическим аппаратурным лечением. Предлагаемый метод профилактики позволил купировать иммунодефицитное состояние, возникающее на этапах ортодонтического лечения, и повысить эффективность профилактики кариеса зубов. ...

24 02 2020 16:38:35

СОЦИАЛЬНЫЕ ФАКТОРЫ ЭЛЕКТОРАЛЬНОЙ ГЕОГРАФИИ

Территориальные различия электоральных предпочтений отличаются высокой устойчивостью в современной России. Этот феномен подтверждается методом корреляционного анализа. Выделяются шесть основных социальных факторов, влияющих на различия в электоральной географии: 1) доля городского населения; 2) приближенность к центру; 3) этнический фактор; 4) доля молодежи в составе населения; 5) преобладающие виды деятельности населения; 6) структура социальных связей. Электоральное поведение в России менее индивидуально, чем в западных странах, большее значение имеют объективные социальные факторы. ...

22 02 2020 13:31:22

ОЦЕНКА ПЕРСПЕКТИВ РАЗВИТИЯ ЛЕСНЫХ КОМПЛЕКСОВ В РЕГИОНАХ С СИЛЬНЫМ АНТРОПОГЕННЫМ ВОЗДЕЙСТВИЕМ

Все более актуальной в настоящее время становится проблема прогнозирования динамики развития региональных лесных комплексов. В качестве одного из этапов исследований по этой теме автором в содружестве с Гринпис России был выполнен описанный в статье проект. В рамках проекта разработана экономико-математическая модель. Последующая реализация модели на компьютере с использованием реальных данных показала ее эффективность для решения задач прогнозирования лесной отрасли. В качестве региона для апробации модели был выбран Санкт- Петербург и область, где влияние человека на окружающую среду в последнее время существенно возросло. Проведенная на основе статистических тестов верификация модели показала ее соответствие реальности. С целью апробации модели были сформированы два сценария с различными значениями показателей внешнего воздействия на региональную систему лесного комплекса. В результате, после имитации были получены основные параметры регионального лесного комплекса, соответствующие двум сценариям. ...

19 02 2020 16:24:29

КЛИНИКО-ЭКСПЕРИМЕНТАЛЬНЫЕ АСПЕКТЫ ИЗУЧЕНИЯ ГЕМОРРАГИЧЕСКОГО СИНДРОМА ПРИ ЦИРРОЗАХ ПЕЧЕНИ

Статья посвящена современным проблемам гепатоэетерологии, в частности геморрагическому синдрому при заболеваниях печени. Основное место уделено алкогольным поражением печени. В статье присутствуют материалы посвященные изучению системы гемостаза, являющиеся сложной и актуальной проблемой в настоящее время. ...

18 02 2020 12:15:45

ВИКТОР МИХАЙЛОВИЧ ПРОВОРОВ

Статья в формате PDF 87 KB...

14 02 2020 15:53:47

ЖИЗНЬ ЭТО...

« Что такое жизнь?» Этот вопрос занимает человечество с древнейших времён. Многие философы и естествоиспытатели пытались и пытаются разрешить этот вопрос, определить жизнь как явление. Существует множество определений жизни, но, несмотря на это, среди них нет ни одного, который бы наиболее полно отразил основной принцип существования жизни, её сущность. В предлагаемой вашему вниманию статье сделана ещё одна попытка объяснения феномена жизни. Её основная идея: Жизнь - это самовоспроизводящийся катализатор диссипации энергии. Что касается самовоспроизведения, то здесь всё более или менее понятно, а вот словосочетание «катализатор диссипации» требует некоторых разъяснений. Диссипация - термин, обозначающий рассеяние энергии, т.е. её переход с потенциально более высокого уровня на более низкий - тепловой уровень. В свете рассматриваемого определения жизни подразумевается, что энергия квантов солнечного света, которые могут странствовать в космосе «бесконечно», будучи поглощенной растениями поэтапно диссипатируется, в процессах жизнедеятельности и формирования собственных структур последовательными участниками пищевой цепи (растение - травоядное - хищник - падальщики), в тепловое излучение. Таким образом, живое вещество, многократно ускоряя процесс диссипации энергии солнечных квантов в тепловое излучение, играет в нем роль специфического катализатора. Далее рассматривается ряд важных следствий, вытекающих из данного определения. ...

13 02 2020 21:19:23

НЕКОТОРЫЕ АСПЕКТЫ НАРКОПРЕСТУПНОСТИ

Статья в формате PDF 251 KB...

03 02 2020 18:27:32

ИЗМЕНЕНИЕ КАПСУЛЫ СЕЛЕЗЕНКИ В УСЛОВИЯХ ХРОНИЧЕСКОЙ АЛКОГОЛЬНОЙ ИНТОКСИКАЦИИ

Статья посвящена актуальной проблеме – влиянию хронической алкогольной интоксикации на изменение структуры капсулы селезенки в раннем постнатальном онтогенезе. Дана сравнительная гистологическая характеристика капсулы с учетом зависимости изменений от различной концентрации потребляемого алкоголя. ...

30 01 2020 10:40:30

ОПЫТ ПРИМЕНЕНИЯ МЕТОДА АГРОСТЕПЕЙ ДЛЯ ВОССТАНОВЛЕНИЯ НАРУШЕННОЙ РАСТИТЕЛЬНОСТИ ДОЛИНЫ СРЕДНЕЙ ЛЕНЫ (ЦЕНТРАЛЬНАЯ ЯКУТИЯ)

Анализ опыта по восстановлению методом агростепей растительности на нарушенных кормовых угодьях долины средней Лены показал, что метод при соблюдении экологических условий и видового состава участков обеспечивает восстановление растительности, проявляющееся в повышении проективного покрытия и доминировании в травостое целинных видов. Соответствие экологических условий и видового состава травостоя при подборе участков обеспечивает восстановление растительности нарушенных участков до 70–75 % и доминирование в травостое целинных видов до 60–65 % в условиях нормального и сильного засоления. ...

27 01 2020 4:47:43

РЫНОК ТРУДА И ТРУДОУСТРОЙСТВО МОЛОДЫХ СПЕЦИАЛИСТОВ

Статья в формате PDF 145 KB...

22 01 2020 16:21:56

МЕЛКИЕ МЛЕКОПИТАЮЩИЕ В ТРАНСФОРМИРОВАННЫХ УРБАНИЗАЦИЕЙ ЛЕСНЫХ ЭКОСИСТЕМАХ

По комплексу признаков оценили трансформированные урбанизацией лесные фитоценозы, и населяющие их сообщества мелких млекопитающих в лесопарково-парковой зоне крупного промышленного центра. Выявили, что хотя и наблюдаются общие закономерности в группировке фито- и зооценозов в зависимости от уровня и характера урбаногенного воздействия, но между ними нет полного соответствия. Специфика сообществ мелких млекопитающих определяется не только эдафо-растительными условиями. Ведущим параметром в трансформации сообществ является рекреация и сопровождающие ее факторы. ...

17 01 2020 13:40:49

ЧЕЛОВЕЧЕСКИЙ КАПИТАЛ В ЯДЕРНОМ ТЭК РОССИИ

Статья в формате PDF 108 KB...

09 01 2020 18:42:33

Еще:
Обзоры -1 :: Обзоры -2 :: Обзоры -3 :: Обзоры -4 :: Обзоры -5 :: Обзоры -6 :: Обзоры -7 :: Обзоры -8 :: Обзоры -9 :: Обзоры -10 :: Обзоры -11 ::

Последовательность подготовки научной работы может быть такой:

Выбор темы. Это важный этап. Во-первых, тема должна быть интересна не только вам, но и большинству слушателей, которым вы будете её докладывать, чтобы вы видели заинтересованность в их глазах, а не откровенную скуку.

Выбор целей и задач своей научной работы. То есть, нужно сузить тему. Например, тема: «Грудное вскармливание», сужение темы: «Грудное вскармливание среди студенток нашего ВУЗа». И если общая тема мало кому интересна, то суженная до рамок собственного института или университета, она становится интересной практически для всех слушателей. Целью может стать: «Содействие оптимальным условиям вскармливания грудью детей студентов нашего ВУЗа», а задачей — доказать, что специальные условия, созданные для кормящих студенток, не помешают их успеваемости, но уменьшат количество пропусков, академических отпусков и способствуют выращиванию здоровых детей — нашего будущего. Понятно, что эта тема подходит для студентов медицинских и педагогических ВУЗов, но и в других учебных учреждениях можно найти темы, интересные всем.

Разработать методы исследования и сбора информации. В случае с естественным вскармливанием, скорее всего, это будет анкетирование студенток, имеющих детей.

Систематизировать материал и подготовить презентацию.

Подготовиться к выступлению.

Выступить и получить: награду, удовольствие и опыт, чтобы в следующем году выступить ещё лучше и сорвать шквал аплодисментов, стать узнаваемым, а значит — более конкурентоспособным!