IT-Reviews    

РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ

c78089d0 Источник:
Рзаева А.Ш. Впервые было изучено интерлейкина – 8 – 251 ТА среди женщин Азербайджана больными эндометриозом. 50 практически здоровых и 70 женщин больных эндомертиозом находились под нашем наблюдением. Исследование показали что, генетический полиморизм интерлейкина – 8 А/Т 251 играет роль в потогенезе эндометриоза. Статья в формате PDF 236 KB эндометриозинтерлейкина – 8генетический полиморизм

Эндометриоз дисгормоналное, иммунозависимое и генетически обусловленное заболевания с доброкачественным разрастанием ткани, сходной по морфологическому строению и функции с эндометрием, но находящейся за пределами матки [1].

Больные с различными формами этой патологии страдают стойким болевым синдромом, нарушениями менструального цикла, дисфункциональными маточными кровотечениями и подвергаются многократным лечебно - диагностическим выскабливанием матки, оперативным вмешательствам, нередко бесполезным терапевтическим воздействием. [3]

Тазовая боль и вегетативно-сосудистые нарушения заставляют этих женщин обращаться ко многим специалистам, в том числе к психиатрам и психоневрологам.

Частота заболевания у женщин репродуктивного возраста, по данным различных авторов варьирует от 7 до 50 %, причем в последние годы отмечается неуклонный рост данной патологии [9, 10, 11]. Установлено что 30-40 % больных эндометриозом страдают бесплодием и невынашиванием беременности. Не менее чем у 78 % больных, получивших медикаментозную терапию по поводу эндометриоза отмечается персистенция заболевания и его рецидивы. [2]

Не смотря на значительное увеличение числа научных и клинических исследований, посвященных различным аспектам эндометриоза, многие вопросы его этиопатогенеза, диагностики, течение и терапии остаются спорными.

В настоящее время считается доказанным, что выживание и имплантация жизнеспособных фрагментов эндометрия в перитонеальной поверхности обусловлены нарушениям локального иммунного ответа.

У женщин страдающих эндометриозом увеличено содержание перитонеалных макрофагов, усилена их активность и секреция ими различных цитокинов. В последние годы было доказано что в организме женщин больных эндометриозом повышается содержание провоспалительного цитокина интерлейкина - 8 [4, 5, 6,].

Выявлено что за продукцию ИЛ-8 отвечает 13q-21q регион 4-й хромосомы. Генетический полиморфизм ТА в - 251 участке повышает продукцию ИЛ-8 [7, 8].

В Азербайджанской популяции изучению генетической зависимости эндометриоза способствует этническая однородность популяции, высокая частота данного заболевания среди женщин репродуктивного возраста, в связи с чем значительный научный интерес представляют исследования по изучению полиморфизма гена отвечающего за экспрессию интерлейкина - 8.

Целю нашего исследования разработать методы прогнозирования и ранней диагностики эндометриоза по данным полиморфизмов гена ИЛ-8 среди женщин Азербайджанской популяции.

Материалы и методы исследования

Под нашим наблюдением находилась 70 больных страдающих эндометриозом. Диагноз быль подтвержден после операционного вмешательство. Больные были в возрасте от 15 до 56 лет. Длительность заболевания колебалось от нескольких месяцев до 6 лет.

Наряду с общеклиническим обследованием больным было проведено комплексное инструментальное исследование с использованием гистероскопии, гистеросальпингографии, эхографии. Также у всех больных было проведено генетическая тестирование на определения полиморфизма ИЛ-8-251 - АТ.

Контрольную группу составили 50 практически здоровых женщин.

Для выявления полиморфизма ИЛ-8-251-ТА было использовано метод PCR-ARMS.

Участок для амплификации быль выбран на основании материалов предоставленных NCBİ SNP под номером rs4073:

F1, 5′ - GTTATCTAGAAATAAAAAAGCATACAA - 3′;

R1, 5′ - CTCATCTTTTCATTATGTCAGAG - 3′;

F2, 5′ - CATGATAGCATCTGTAATTAACTG - 3′;

R2, 5′ - CACAATTTGGTGAATTATCAA - 3′.

Для проведения реакции были использованы следующие реагенты:

DNT-5μl; Buffer 2,5μ; MgCl2-1,75μl; dNTP-0,5μl, из каждого примера 10 pmol; Taq A - 0,2μl.

Реакция PCR было проведено по следующему протоколу:

94 ºC - 5 мин - 1 цикл, 94 ºC - 30 мин, 54 ºC - 30 с, 72 ºC - 30 с, 35 цикл и 72 ºC - 7 мин - 1 цикл.

Полученные материалы были визуализированы после электрофореза в 2 % - ном агорозном геле.

Результаты исследования

Генотипы по полиморфизму ИЛ-8 ТА представлен в табл. 1.

У женщин с эндометриозом генотип ТТ составила 41,4 %. В контрольной группе генотип АА составило 50 % в то время как этот генотип в основной группе составило 21,4 %.

Таблица 1

Распостраненность генотипов ИЛ-8 ТА среди практически здоровых женщин
и больных эндометриозом 

Генотипы

Контроль (n = 50)

Эндометриоз (n = 70)

TT

7 (14 %)

29 (41,4 %)

TA

18 (36 %)

26 (37,2 %)

AA

25 (50 %)

15 (21,4 %)

Популяция было в пределах равновесия по закону Харди - Вайнберга. p > 0,05

Также эти группы отличались друг от друга по аллелным показателям.

Так как, у женщин страдающих эндометриозом частота алела Т составило 60 %. Этот показатель был выше, чем в контрольной группе. В контрольной группе частота аллела А составило 68 % в то время как частота алела Т было всего 32 %.

Нами было выявлено связь между генотипом Т/Т и эндометриозом. Частота генотипа Т/Т у женщин страдающих эндометриозом было в два раза выше чем в контрольной группе.

Генетическое тестирования женщин повышенного риска развитие эндометриоза представляет важный как теоретический, так и практический интерес. Выявления полиморфизма гена ИЛ-8 позволит на доклиническом этапе определить возможный риск развитие эндометриоза и заблаговременно начать индивидуальную профилактику этого заболевания.

Таблица 2

Частота аллелов по полиморфизму ИЛ-8 - 251 АТ среди женщин
с эндометриозом и в контрольной группе 

Аллели

Контроль (n = 100)

Эндометриоз (n = 140)

T

32 (32 %)

84 (60 %)

A

68 (68 %)

56 (40 %)

 Список литературы

  1. Кулаков В.И., Андреева Е.Н. Эндометриозы. - М.: Медицина, 2006. - 410 с.
  2. Поморцев А.В., Гудков В.Г., Дегтярев А.М. Гормональный профиль больных наружным генитальным эндометриозом в различные фазы менструального цикла // Акуш. и гин. - 2002. - №1 - С. 35-42.
  3. Сидорова И.С., Коган К.А. Новый взгляд на природу эндометриоза // Акуш. и гин. - 2002. - № 3. - С. 32-37.
  4. Halme J., Becker S., Haskill S. Altered maturation and functional of peritoneal macrophages: possible role in pathogenesis of endometriosis // J. Obstet.Gynecol. - 1987. - P. 783-789.
  5. Hill J. A. et al. Effects of soluble products of activated macrophages on human sperm motion parameters // J. Fertil. Steril. - 1987. - №47. - P. 460-465.
  6. Halme J. Release of tumor necrosis fector by human peritoneal macrophages in vivo and in vitro // J. Obst. And Gynecol. - 1989. -№161. - P. 1718-1725.
  7. Hull J. Thomson A, Kviatkovski D. Assocation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families // J. Thorax. - 2000. - v. 55. - P. 1023-1027.
  8. Junko Fujihara, kuninori Shiwaku, Toshihiro Yasuda et all. Variation of interleukin -8 - 251 AT polymorphism in worldwide populations and intra-ethnic differences in Japanese populations. // Clinica Chimica Acta 337. - 2007. - P. 79-82.
  9. Karen Kinkel, Kathrin A. Frei. Diagnosis of endometriosis with imaging: a review. Eur. Radiol. - 2006. internet.
  10. Schindler A.E. Pathophysiology, diaqnosis and treatment of endometriosis // Minevra Ginecol. - P. 419-435.
  11. Vigano P, Parazzini F, Somigliana E. // Endometriosis: epidemiology and aetiological factors // J. Obstet. And Gynaecol. - 2004. - №18. - P. 177-200.



Отзывы (через Facebook):

Оставить отзыв с помощью аккаунта FaceBook:

ЭКОНОМИЧЕСКОЕ СОДЕРЖАНИЕ ЗЕМЕЛЬНОГО НАЛОГА

Статья в формате PDF 135 KB...

27 10 2020 23:55:44

ЯЗЫКОВАЯ СПЕЦИФИКА АНГЛО- И РУССКОЯЗЫЧНЫХ БЛОГОВ

Статья в формате PDF 261 KB...

14 10 2020 9:40:58

СОВРЕМЕННОЕ СОЦИАЛЬНОЕ ОБРАЗОВАНИЕ В РОССИИ

Статья в формате PDF 128 KB...

13 10 2020 20:46:55

Медико-экологическая оценка состояния здоровья населения г. Сатпаев по данным обращаемости

Проведен анализ динамики заболеваемости по отдельным возрастным группам населения г. Сатпаев. Результаты показали, что общим явлением для всех возрастных групп было значительное учащение после аварии болезней органов дыхания, а у взрослых и подростков – болезней мочеполовой системы. Заболеваемость детского населения в 2007 г. возросла по сравнению с 2006 г. в 1,3 раза, различия достоверны с высоким уровнем вероятности такого утверждения (26782,3 ± 333,4‰ против 34393,1 ± 359,8‰, t = 15,3, p < 0,001). Анализ ситуаций, показал, что психо-эмоциональный стресс, вызывающий обострение многих хронических и появление новых нозологических форм заболеваний, тесно связан с психо-эмоциональным состоянием типа высшей нервной деятельности человека. ...

07 10 2020 15:37:49

СТАНОВЛЕНИЕ РЕПРОДУКТИВНОЙ СИСТЕМЫ НОВОРОЖДЕННЫХ

Статья в формате PDF 145 KB...

29 09 2020 18:24:51

АНДРАГОГИЧЕСКИЕ ПРОБЛЕМЫ В ПРОФЕССИОНАЛЬНОЙ ПОДГОТОВКЕ МЕДИЦИНСКИХ РАБОТНИКОВ

Обучение взрослых дипломированных специалистов существенно отличается от обучения студентов. Если на додипломном уровне приемлема педагогическая модель обучения с доминантой обучающего, то на этапе же последипломного образования необходимо руководствоваться продуктивной андрагогической моделью обучения. Её главный постулат: обучающийся – ведущее звено в процессе образования. Исходя из этого, в течение ряд лет мы используем методику психологического типирования личности американского исследователя Д. Кейрси. И на основании выявления уровней подготовки, психофизиологических и личностных особенностей обучающихся практикуем деловые игры, мастер-классы, создание взрослыми обучающимися порт-фолио непосредственно на рабочем месте. Результаты положительные. ...

25 09 2020 15:29:22

КРИПТОГРАФИЯ – ОТ ИЗБРАННЫХ К ШИРОКИМ МАССАМ

Статья в формате PDF 114 KB...

22 09 2020 13:35:57

ЭПИДЕМИЧЕСКАЯ БЕЗОПАСНОСТЬ ТУРИСТА

Статья в формате PDF 116 KB...

17 09 2020 23:56:37

АНАЛИЗ РАЗВИТИЯ СТРАХОВАНИЯ В СССР

Статья в формате PDF 310 KB...

15 09 2020 10:15:10

АВТОРИТЕТ ПРЕПОДАВАТЕЛЯ-ВРАЧА

Статья в формате PDF 94 KB...

14 09 2020 20:53:26

БОДРОВА ТАМАРА НИКОЛАЕВНА

Статья в формате PDF 156 KB...

09 09 2020 13:24:39

РОЛЬ АУДИТОРИИ В УЧЕБНОМ ПРОЦЕССЕ

Статья в формате PDF 108 KB...

07 09 2020 11:54:34

АНАЛЬГЕТИЧЕСКАЯ АКТИВНОСТЬ ОТВАРОВ КОРЫ И ОДНОЛЕТНИХ ПОБЕГОВ ИВЫ БЕЛОЙ

Объект исследования – ива белая, которая распространена практически по всей территории Европейской части России. За рубежом препараты и Б А Д из различных видов ивы активно применяются при заболеваниях суставов. В соответствии с Руководством по доклиническому изучению новых фармакологических веществ ( Р. У. Хабриев, 2005) оценивали эффективность анальгетического действия и токсичность отваров коры и однолетних побегов ивы белой на мышах. Отвары коры и побегов ивы относятся к классу малоопасные соединения и проявляют выраженную анальгетическую активность, сопоставимую с препаратом сравнения анальгином (метамизол). ...

27 08 2020 6:59:28

Качество жизни детей, больных вирусными гепатитами

Статья в формате PDF 136 KB...

23 08 2020 6:52:36

ГЕННАДИЙ ФЕДОРОВИЧ КИСЕЛЕВ

Статья в формате PDF 205 KB...

22 08 2020 10:59:35

ЛЕЧЕНИЕ БОЛЬНЫХ С УКУШЕННЫМИ РАНАМИ

Статья в формате PDF 121 KB...

14 08 2020 19:47:10

ГЛОБАЛИЗАЦИЯ И ЕЕ ВЛИЯНИЕ НА КУЛЬТУРНЫЕ ПРОЦЕССЫ

Статья в формате PDF 180 KB...

10 08 2020 0:35:32

ДЕСТРУКЦИЯ ЭРИТРОЦИТОВ В КОСТНОМОЗГОВЫХ ЭРИТРОКЛАЗИЧЕСКИХ КЛАСТЕРАХ

В костном мозге больных гематологическими заболеваниями выявлено значительное количество эритроклазических кластеров, характеризующихся экзоцитарным лизисом входящих в них эритроцитов кластерообразующими миелокариоцитами разных видов, включая эритрокариоциты. Содержание эритроклазических кластеров с происходящим в них экзоцитарным лизисом эритроцитов варьировало от 21% от всех эритроклазических кластеров в костном мозге больных апластической анемией до 81% в костном мозге больных в активной фазе острого лимфобластного лейкоза, что свидетельствует об интенсивности лизиса в них эритроцитов. С наибольшей интенсивностью лизис эритроцитов происходил в костном мозге больных в активную фазу острого лимфобластного лейкоза и больных хроническим миелолейкозом. При этом в момент исследования подвергались деструкции в эритроклазических кластеров десятки тысяч эритроцитов в мкл костного мозга. Эти данные подтверждают представление о костном мозге как органе гемолиза. ...

08 08 2020 6:26:45

ТРАНСФОРМАЦИЯ НАСЕЛЕНИЯ ОХОТНИЧЬЕ-ПРОМЫСЛОВЫХ МЛЕКОПИТАЮЩИХ ПРИ ОСВОЕНИИ ЧАЯНДИНСКОГО ЛИЦЕНЗИОННОГО УЧАСТКА (ЗАПАДНАЯ ЯКУТИЯ)

В сообщении представлены сведения о трансформации населения охотничье-промысловых млекопитающих при освоении Чаяндинского лицензионного участка ( Западная Якутия). Материалы собраны в 2009–2011 гг. В результате проведенных учетных работ и опросных сведений на территории лицензионного участка выявлено обитание 10 видов охотничье-промысловых млекопитающих из 20 видов, обитающих на территории Западной Якутии. На настоящий момент существенных изменений численности охотничье-промысловых животных на лицензионном участке не происходит. В целом воздействие геологоразведочных работ на нефть и газ носят локальный характер. ...

07 08 2020 2:44:49

ЭКСПЕРИМЕНТАЛЬНОЕ ИССЛЕДОВАНИЕ ВЛИЯНИЯ ЭЛЕКТРОФИЗИЧЕСКИХ ФАКТОРОВ НА УРОЖАЙНОСТЬ ОВОЩНЫХ КУЛЬТУР

В работе представлены результаты исследования влияния высокоинтенсивных физических факторов электрического поля коронного разряда ( Э П К Р), создаваемого установкой « Экран», и некогерентных световых импульсов ( Н С И), создаваемых установкой « Стимул» [1, 2], на семена овощных культур, с целью повышения урожайности. По результатам исследования выявлено, что все использованные в эксперименте режимы высокоинтенсивного физического воздействия на семена овощных культур оказывают стимулирующий биологический эффект при оценке урожайности. Определено, что наиболее эффективными режимами Э П К Р для повышения урожайности овощных культур являются режимы с напряженностью электрического поля 3,5 к В/см и 5 к В/см. Выявлено, что наиболее эффективными режимами Н С И для повышения урожайности овощных культур является режим с запасенной суммарной электрической энергией импульсного источника энерго-питания 80 к Дж. Показано, что при воздействии на посадочный материал картофеля Н С И с запасенной суммарной электрической энергией 40 к Дж наблюдается стимулирование роста, развития, повышение всхожести и сокращение вегетационного периода картофеля. Кроме того, данное физическое воздействие вызывает повышение качества урожая картофеля, т.к. вес и количество крупных и средних клубней в опытной группе значительно больше, чем в контрольной. ...

06 08 2020 9:40:49

ФОРМИРОВАНИЕ ПРОСТРАНСТВА ПОЗНАВАТЕЛЬНЫХ КОММУНИКАЦИЙ. КВАЗИРЕЧЕВОЙ ДИАЛОГ В УЧЕБНОМ ПОСОБИИ

Выделены навыки социальной коммуникации, необходимые для успешного освоения химических дисциплин. Предложен один из путей снятия напряженности в процессе общения преподавателя и студента - виртуальный письменный диалог, реализованный в виде учебного пособия. Используемые в пособии методические приемы позволяют наиболее полно сформировать необходимый инструментарий познания: (логические операции + социальная коммуникация) → понимание → знание. ...

31 07 2020 1:53:37

Пимнева Людмила Анатольевна

Статья в формате PDF 148 KB...

27 07 2020 11:50:18

ВОЗМОЖНЫЕ НАПРАВЛЕНИЯ ПСИХОЛОГИЧЕСКОЙ АДАПТАЦИИ ЛИЦ ПОЖИЛОГО ВОЗРАСТА

Изменяющиеся условия жизни приводят к изменению поведения и психологии наиболее уязвимых групп населения, к которым относятся пожилые и старые люди. Наиболее значимыми считаются адаптивные защитные реакции, такие как озабоченность, тревожность, депрессия. Работа поддержана и финансируется Министерством образования и науки. ...

22 07 2020 19:34:10

УНИВЕРСАЛЬНЫЙ БЛОК УПРАВЛЕНИЯ ЭНЕРГОНАГРУЗКАМИ

Статья в формате PDF 122 KB...

19 07 2020 6:23:36

ИНФОРМАЦИОННЫЕ ТЕХНОЛОГИИ УПРАВЛЕНИЯ

Статья в формате PDF 226 KB...

10 07 2020 5:47:52

ВОДА – НОСИТЕЛЬ ИНФОРМАЦИИ В ВОЛНОВОЙ ГЕНЕТИКЕ

Статья в формате PDF 101 KB...

07 07 2020 2:52:50

ИММУНОЛОГИЧЕСКИЕ ПОКАЗАТЕЛИ ДЕТЕЙ г. КРАСНОЯРСКА

Статья в формате PDF 109 KB...

20 06 2020 4:48:59

ИСПОЛЬЗОВАНИЕ АЛЬГОЛОГИЧЕСКИХ КРИТЕРИЕВ ПРИ ЭКОЛОГИЧЕСКОМ ПРОГНОЗИРОВАНИИ АНТРОПОГЕННОЙ НАГРУЗКИ НА НАЗЕМНЫЕ ЭКОСИСТЕМЫ

Обсуждаются возможности использования микроскопических почвенных водорослей при оценке качества окружающей среды. Показано, что в качестве критериев при прогнозировании антропогенной нагрузки на наземные экосистемы можно использовать изменение видового состава и численности почвенных водорослей. ...

18 06 2020 6:28:13

КОНФОРМАЦИОННАЯ ИЗОМЕРИЗАЦИЯ МЕТИЛБОРНОЙ КИСЛОТЫ

Статья в формате PDF 127 KB...

16 06 2020 8:56:32

ОСОБЕННОСТИ НЕПРЕРЫВНОЙ МНОГОУРОВНЕВОЙ ПОДГОТОВКИ СПЕЦИАЛИСТОВ В ЕДИНОМ ПЕДАГОГИЧЕСКОМ ПРОСТРАНСТВЕ "ШКОЛА-КОЛЛЕДЖ-ВУЗ"

В работе выявлены специфические особенности непрерывной многоуровневой подготовки специалистов в едином педагогическом пространстве « Школа – Колледж – В У З », позволяющие с иной точки зрения подходить к отдельным аспектам модернизации непрерывного образования. ...

04 06 2020 18:16:13

СПОСОБ ЛЕЧЕНИЯ ГИПЕРТРОФИЧЕСКИХ РУБЦОВ

Статья в формате PDF 111 KB...

02 06 2020 4:22:31

Еще:
Обзоры -1 :: Обзоры -2 :: Обзоры -3 :: Обзоры -4 :: Обзоры -5 :: Обзоры -6 :: Обзоры -7 :: Обзоры -8 :: Обзоры -9 :: Обзоры -10 :: Обзоры -11 ::

Последовательность подготовки научной работы может быть такой:

Выбор темы. Это важный этап. Во-первых, тема должна быть интересна не только вам, но и большинству слушателей, которым вы будете её докладывать, чтобы вы видели заинтересованность в их глазах, а не откровенную скуку.

Выбор целей и задач своей научной работы. То есть, нужно сузить тему. Например, тема: «Грудное вскармливание», сужение темы: «Грудное вскармливание среди студенток нашего ВУЗа». И если общая тема мало кому интересна, то суженная до рамок собственного института или университета, она становится интересной практически для всех слушателей. Целью может стать: «Содействие оптимальным условиям вскармливания грудью детей студентов нашего ВУЗа», а задачей — доказать, что специальные условия, созданные для кормящих студенток, не помешают их успеваемости, но уменьшат количество пропусков, академических отпусков и способствуют выращиванию здоровых детей — нашего будущего. Понятно, что эта тема подходит для студентов медицинских и педагогических ВУЗов, но и в других учебных учреждениях можно найти темы, интересные всем.

Разработать методы исследования и сбора информации. В случае с естественным вскармливанием, скорее всего, это будет анкетирование студенток, имеющих детей.

Систематизировать материал и подготовить презентацию.

Подготовиться к выступлению.

Выступить и получить: награду, удовольствие и опыт, чтобы в следующем году выступить ещё лучше и сорвать шквал аплодисментов, стать узнаваемым, а значит — более конкурентоспособным!