IT-Reviews    

РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ

Рекомендуем: фильм Запрещенный прием (Россия) - пересказ сюжета, спойлеры
Источник:
Рзаева А.Ш. Впервые было изучено интерлейкина – 8 – 251 ТА среди женщин Азербайджана больными эндометриозом. 50 практически здоровых и 70 женщин больных эндомертиозом находились под нашем наблюдением. Исследование показали что, генетический полиморизм интерлейкина – 8 А/Т 251 играет роль в потогенезе эндометриоза. Статья в формате PDF 236 KB эндометриозинтерлейкина – 8генетический полиморизм

Эндометриоз дисгормоналное, иммунозависимое и генетически обусловленное заболевания с доброкачественным разрастанием ткани, сходной по морфологическому строению и функции с эндометрием, но находящейся за пределами матки [1].

Больные с различными формами этой патологии страдают стойким болевым синдромом, нарушениями менструального цикла, дисфункциональными маточными кровотечениями и подвергаются многократным лечебно - диагностическим выскабливанием матки, оперативным вмешательствам, нередко бесполезным терапевтическим воздействием. [3]

Тазовая боль и вегетативно-сосудистые нарушения заставляют этих женщин обращаться ко многим специалистам, в том числе к психиатрам и психоневрологам.

Частота заболевания у женщин репродуктивного возраста, по данным различных авторов варьирует от 7 до 50 %, причем в последние годы отмечается неуклонный рост данной патологии [9, 10, 11]. Установлено что 30-40 % больных эндометриозом страдают бесплодием и невынашиванием беременности. Не менее чем у 78 % больных, получивших медикаментозную терапию по поводу эндометриоза отмечается персистенция заболевания и его рецидивы. [2]

Не смотря на значительное увеличение числа научных и клинических исследований, посвященных различным аспектам эндометриоза, многие вопросы его этиопатогенеза, диагностики, течение и терапии остаются спорными.

В настоящее время считается доказанным, что выживание и имплантация жизнеспособных фрагментов эндометрия в перитонеальной поверхности обусловлены нарушениям локального иммунного ответа.

У женщин страдающих эндометриозом увеличено содержание перитонеалных макрофагов, усилена их активность и секреция ими различных цитокинов. В последние годы было доказано что в организме женщин больных эндометриозом повышается содержание провоспалительного цитокина интерлейкина - 8 [4, 5, 6,].

Выявлено что за продукцию ИЛ-8 отвечает 13q-21q регион 4-й хромосомы. Генетический полиморфизм ТА в - 251 участке повышает продукцию ИЛ-8 [7, 8].

В Азербайджанской популяции изучению генетической зависимости эндометриоза способствует этническая однородность популяции, высокая частота данного заболевания среди женщин репродуктивного возраста, в связи с чем значительный научный интерес представляют исследования по изучению полиморфизма гена отвечающего за экспрессию интерлейкина - 8.

Целю нашего исследования разработать методы прогнозирования и ранней диагностики эндометриоза по данным полиморфизмов гена ИЛ-8 среди женщин Азербайджанской популяции.

Материалы и методы исследования

Под нашим наблюдением находилась 70 больных страдающих эндометриозом. Диагноз быль подтвержден после операционного вмешательство. Больные были в возрасте от 15 до 56 лет. Длительность заболевания колебалось от нескольких месяцев до 6 лет.

Наряду с общеклиническим обследованием больным было проведено комплексное инструментальное исследование с использованием гистероскопии, гистеросальпингографии, эхографии. Также у всех больных было проведено генетическая тестирование на определения полиморфизма ИЛ-8-251 - АТ.

Контрольную группу составили 50 практически здоровых женщин.

Для выявления полиморфизма ИЛ-8-251-ТА было использовано метод PCR-ARMS.

Участок для амплификации быль выбран на основании материалов предоставленных NCBİ SNP под номером rs4073:

F1, 5′ - GTTATCTAGAAATAAAAAAGCATACAA - 3′;

R1, 5′ - CTCATCTTTTCATTATGTCAGAG - 3′;

F2, 5′ - CATGATAGCATCTGTAATTAACTG - 3′;

R2, 5′ - CACAATTTGGTGAATTATCAA - 3′.

Для проведения реакции были использованы следующие реагенты:

DNT-5μl; Buffer 2,5μ; MgCl2-1,75μl; dNTP-0,5μl, из каждого примера 10 pmol; Taq A - 0,2μl.

Реакция PCR было проведено по следующему протоколу:

94 ºC - 5 мин - 1 цикл, 94 ºC - 30 мин, 54 ºC - 30 с, 72 ºC - 30 с, 35 цикл и 72 ºC - 7 мин - 1 цикл.

Полученные материалы были визуализированы после электрофореза в 2 % - ном агорозном геле.

Результаты исследования

Генотипы по полиморфизму ИЛ-8 ТА представлен в табл. 1.

У женщин с эндометриозом генотип ТТ составила 41,4 %. В контрольной группе генотип АА составило 50 % в то время как этот генотип в основной группе составило 21,4 %.

Таблица 1

Распостраненность генотипов ИЛ-8 ТА среди практически здоровых женщин
и больных эндометриозом 

Генотипы

Контроль (n = 50)

Эндометриоз (n = 70)

TT

7 (14 %)

29 (41,4 %)

TA

18 (36 %)

26 (37,2 %)

AA

25 (50 %)

15 (21,4 %)

Популяция было в пределах равновесия по закону Харди - Вайнберга. p > 0,05

Также эти группы отличались друг от друга по аллелным показателям.

Так как, у женщин страдающих эндометриозом частота алела Т составило 60 %. Этот показатель был выше, чем в контрольной группе. В контрольной группе частота аллела А составило 68 % в то время как частота алела Т было всего 32 %.

Нами было выявлено связь между генотипом Т/Т и эндометриозом. Частота генотипа Т/Т у женщин страдающих эндометриозом было в два раза выше чем в контрольной группе.

Генетическое тестирования женщин повышенного риска развитие эндометриоза представляет важный как теоретический, так и практический интерес. Выявления полиморфизма гена ИЛ-8 позволит на доклиническом этапе определить возможный риск развитие эндометриоза и заблаговременно начать индивидуальную профилактику этого заболевания.

Таблица 2

Частота аллелов по полиморфизму ИЛ-8 - 251 АТ среди женщин
с эндометриозом и в контрольной группе 

Аллели

Контроль (n = 100)

Эндометриоз (n = 140)

T

32 (32 %)

84 (60 %)

A

68 (68 %)

56 (40 %)

 Список литературы

  1. Кулаков В.И., Андреева Е.Н. Эндометриозы. - М.: Медицина, 2006. - 410 с.
  2. Поморцев А.В., Гудков В.Г., Дегтярев А.М. Гормональный профиль больных наружным генитальным эндометриозом в различные фазы менструального цикла // Акуш. и гин. - 2002. - №1 - С. 35-42.
  3. Сидорова И.С., Коган К.А. Новый взгляд на природу эндометриоза // Акуш. и гин. - 2002. - № 3. - С. 32-37.
  4. Halme J., Becker S., Haskill S. Altered maturation and functional of peritoneal macrophages: possible role in pathogenesis of endometriosis // J. Obstet.Gynecol. - 1987. - P. 783-789.
  5. Hill J. A. et al. Effects of soluble products of activated macrophages on human sperm motion parameters // J. Fertil. Steril. - 1987. - №47. - P. 460-465.
  6. Halme J. Release of tumor necrosis fector by human peritoneal macrophages in vivo and in vitro // J. Obst. And Gynecol. - 1989. -№161. - P. 1718-1725.
  7. Hull J. Thomson A, Kviatkovski D. Assocation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families // J. Thorax. - 2000. - v. 55. - P. 1023-1027.
  8. Junko Fujihara, kuninori Shiwaku, Toshihiro Yasuda et all. Variation of interleukin -8 - 251 AT polymorphism in worldwide populations and intra-ethnic differences in Japanese populations. // Clinica Chimica Acta 337. - 2007. - P. 79-82.
  9. Karen Kinkel, Kathrin A. Frei. Diagnosis of endometriosis with imaging: a review. Eur. Radiol. - 2006. internet.
  10. Schindler A.E. Pathophysiology, diaqnosis and treatment of endometriosis // Minevra Ginecol. - P. 419-435.
  11. Vigano P, Parazzini F, Somigliana E. // Endometriosis: epidemiology and aetiological factors // J. Obstet. And Gynaecol. - 2004. - №18. - P. 177-200.



Отзывы (через Facebook):

Оставить отзыв с помощью аккаунта FaceBook:

СОВРЕМЕННЫЕ ПОДХОДЫ К ИММУНИЗАЦИИ НАСЕЛЕНИЯ

Статья в формате PDF 112 KB...

14 04 2021 18:16:26

О ФИЗИОЛОГИИ РАЗВИТИЯ ЛИМФАТИЧЕСКОЙ СИСТЕМЫ

Лимфатическая система с момента закладки является частью единой сердечно-сосудистой системы и образуется в эмбриогенезе путем выключения части первичных вен и их притоков с эндотелиальными стенками из кровотока. Неравномерный рост первичного лимфатического русла с эндотелиальными стенками, в т.ч. путем его частичной магистрализации и редукции, лежит в основе морфогенеза вариабельной дефинитивной лимфатической системы у плодов в прямой связи с закладкой лимфатических узлов. ...

13 04 2021 10:37:43

РАЗВИТИЕ ЕСТЕСТВЕННОНАУЧНЫХ СПОСОБНОСТЕЙ ОДАРЕННЫХ ДЕТЕЙ В СИСТЕМЕ ДОПОЛНИТЕЛЬНОГО ЭКОЛОГИЧЕСКОГО ОБРАЗОВАНИЯ

Система дополнительного экологического образования, базирующаяся на использовании современных педагогических моделей личностно-ориентированного обучения; применении передовых образовательных технологий, активных методов и форм полевой экологии, проектной деятельности, вовлечении в общественно-значимую исследовательскую и практическую работу, создает оптимальные условия для развития креативных способностей одаренных детей в естественнонаучной области. ...

11 04 2021 0:34:29

ЭКСПЕРТНО-ОБУЧАЮЩИЕ СИСТЕМЫ В ОБРАЗОВАНИИ

Статья в формате PDF 310 KB...

09 04 2021 6:21:11

СПОСОБ ЛЕЧЕНИЯ ГИПЕРТРОФИЧЕСКИХ РУБЦОВ

Статья в формате PDF 111 KB...

03 04 2021 10:15:43

ПЕРЕСЕЛЕНЧЕСКИЙ КАПИТАЛИЗМ В США

Статья в формате PDF 320 KB...

01 04 2021 11:57:17

АРХЕТИПИЧЕСКИЕ ОСНОВАНИЯ БЫТИЯ НООСФЕРЫ

Статья в формате PDF 110 KB...

28 03 2021 15:39:25

ДЕМОНСТРАТИВНОСТЬ В ПОВЕДЕНИИ ПОДРОСТКА И ШКОЛА

Статья в формате PDF 307 KB...

23 03 2021 21:58:59

Кристаллографические методы исследования сперматозоидов крыс при воздействии несимметричного диметилгидразина (НДМГ)

Для определения возможности использования кристаллографического метода в оценке нарушений сперматогенеза при действии химических факторов были изучены кристаллограммы лизата сперматозоидов крыс после введения Н Д М Г в дозах 5, 25, 40 и 70 мг/кг. Экспериментальные исследования проводились на белых крысах-самцах. Анализ тезиограмм показал превалирование нарушений с увеличением введенной дозы Н Д М Г, начальные нарушения выявляются на ранних сроках, во всех диапазонах доз Н Д М Г. Максимальные нарушения прослеживаются при острой интоксикации в дозе 70 мг/кг и сроке 24 часа, о чем свидетельствует увеличение центров кристаллизации, формированием грубых монокристаллов и поликристаллов. Изменения кристаллоографической картины в тезиограммах лизата спермы крыс свидетельствуют о метаболических изменениях в сперматозоидах, развивающихся в ответ на действие Н Д М Г, что позволяет рекомендовать кристаллографические методы для оценки действия репродуктивных токсикантов и они могут служить индикаторами функционального состояния организма. ...

22 03 2021 15:19:10

КОНТЕЙНЕРЫ В МЕТОДОЛОГИИ ПРОГРАММИРОВАНИЯ

Статья в формате PDF 101 KB...

16 03 2021 15:20:42

ПРЕПАРАТИВНЫЕ МЕТОДЫ СИНТЕЗА СУЛЬФИДОВ МЕТАЛЛОВ В СРЕДЕ Н-АЛКАНОВ

Разработаны препаративные методы синтеза сульфидов металлов в среде жидких н-алканов. Представлены результаты «дробного» и «свернутого» методов синтеза сульфидов металлов. Состав соединений установлен методами химического, рентгенофазового и рентгенофлуоресцентного анализов. ...

12 03 2021 5:38:39

ПОДЖЕЛУДОЧНАЯ ЖЕЛЕЗА У БЕЛОЙ КРЫСЫ

Статья в формате PDF 297 KB...

09 03 2021 15:34:35

ОЦЕНКА КЛИНИЧЕСКОЙ ЭФФЕКТИВНОСТИ АНТИБИОТИКОТЕРАПИИ САЛЬМОНЕЛЛЕЗОВ У ДЕТЕЙ

В работе проводились исследования 129 больных в возрасте от 1 месяца до 14 лет. У 68 (52,7 %) детей был диагностирован сальмонеллез еnteritidis, а у 61 (47,3 %) – сальмонеллез typhimurium. В ходе исследования проведена оценка клинической эффективности антибиотикотерапии с определением чувствительности к антимикробным препаратам. Выявлено, устойчивость клафорана к действию большинства бета-лактамаз, определена его клиническая эффективность в терапии тяжелых форм сальмонеллеза еnteritidis. Подтверждена не высокая эффективность монотерапии ципрофлоксацином. Рекомендована коррекция лечения путем использования комбинации препаратов – ципрофлоксацин + меронем. ...

07 03 2021 19:12:37

Признаки конкурентоспособности инженера

Статья в формате PDF 264 KB...

04 03 2021 20:10:26

ОКРУЖАЮЩАЯ СРЕДА И ГЕОГЕЛЬМИНТОЗЫ

Статья в формате PDF 237 KB...

02 03 2021 12:25:52

ЗОЛОТОЕ СЕЧЕНИЕ И ОЦЕНКА ИЗОЛЯЦИИ ТРАНСФРМАТОРОВ

Статья в формате PDF 152 KB...

01 03 2021 6:16:54

ПЕСНЯ НА УРОКАХ ИНОСТРАННОГО ЯЗЫКА

Статья в формате PDF 123 KB...

28 02 2021 6:59:47

АЛГОРИТМ РАСЧЕТА МОДИФИЦИРОВАННОЙ ГЕРТ-СЕТИ

Статья в формате PDF 130 KB...

26 02 2021 19:57:27

ШОШОНИТОВЫЕ ГРАНИТОИДЫ ТИГИРЕКСКОГО МАССИВА АЛТАЯ: ГЕОХИМИЯ, ПЕТРОЛОГИЯ И РУДОНОСНОСТЬ

риведены геологические, геохимические и петрологические данные по шошонитовым гранитоидам Тигирекского массива Алтая. В составе массива выделены 5 фаз: 1 – габбро; 2 – диориты, монцодиориты; 3 − сиениты, гранодиориты, граносиениты; 4 – граниты, умеренно-щелочные граниты; 5 – лейкограниты, умеренно-щелочные лейкограниты с флюоритом. Породные типы массива отнесены к нормальной известково-щелочной и высококалиевой шошонитовой сериям. Сиениты и монцодиориты тяготеют по составу к банакитам. В процессе становления массива проихсодила диффреренциация глубинного очага с фракционированием редкоземельных элементов, что отразилось на соотношении в породах элементов групп LILE и HFSE со значительной деплетированностью последних. В породах происходила смена типа тетрадного фракционрования редкоземельных элементов, что связано с различной насыщенностью расплавов флюидами и летучимим компонентами. С массивом связаны месторождения и проявления железа, вольфрамаа, молибдена, бериллия, аквамарина, горного хрусталя и раухтопаза. ...

22 02 2021 21:18:18

АКСИОЛОГИЧЕСКИЕ АСПЕКТЫ ЗДОРОВОГО ОБРАЗА ЖИЗНИ

Статья в формате PDF 119 KB...

09 02 2021 7:20:24

ЭХОГРАФИЧЕСКИЕ МАРКЕРЫ ВНУТРИУТРОБНОЙ ИНФЕКЦИИ

Одной из важнейших проблем современной перинатологии является прогрессирующий рост инфекционной патологии у плода и новорожденного. Целью данной работы являлась комплексная ультразвуковая оценка фето-плацентарной системы у беременных с высоким инфекционным индексом для прогнозирования степени тяжести внутриутробного инфицирования у новорожденного. Обследовано 123 беременных в сроке гестации 30-36 недель. В зависимости от тяжести состояния все новорожденные ретроспективно были разделены на 4 группы. В контрольную (1 группа) вошли новорожденные от матерей с неосложненной беременностью, состояние ребенка при рождении удовлетворительное. В основную (1 – 4 группы) вошли новорожденные от матерей с высоким инфекционным индексом, с локальными или генерализованными проявлениями внутриутробной инфекции. В результате проведенного исследования выявлены эхографические маркеры амнионита, плацентита и собственно инфекционного поражения плода, которое наиболее значимо для прогнозирования рождения ребенка с В У И. Патологические показатели биофизической активности, допплерометрия отражают системные нарушения в состоянии плода, его дисстресс. Таким образом, чем больше эхографических маркеров внутриутробного инфицирования встречается у плода, тем более вероятно рождение ребенка с признаками В У И. ...

06 02 2021 22:59:44

ЗДОРОВЬЕ ДЕТЕЙ ЛИЦ, ПЕРЕБОЛЕВШИХ ХЛОРАКНЕ

Статья в формате PDF 109 KB...

01 02 2021 17:43:13

САЛЬМОНЕЛЛЕЗ

Статья в формате PDF 102 KB...

31 01 2021 11:23:42

РОБАСТНАЯ СТАБИЛИЗАЦИЯ ДИСКРЕТНОИМПУЛЬСНЫХ СИСТЕМ

Статья в формате PDF 126 KB...

25 01 2021 13:48:40

Договор купли продажи

Статья в формате PDF 103 KB...

15 01 2021 22:18:59

ХАШАЕВ ЗАУР ХАДЖИ-МУРАДОВИЧ

Статья в формате PDF 113 KB...

14 01 2021 2:48:35

ОСОБЕННОСТИ ИММУНИТЕТА У ДЕТЕЙ С ЗУБОЧЕЛЮСТНЫМИ АНОМАЛИЯМИ И ДЕФОРМАЦИЯМИ

Исследование позволило выявить несбалансированность иммунной системы на протяжении всего периода активного аппаратурного лечения. Это чётко прослеживается через один и через пять месяцев после фиксации аппарата, а так же в конечном периоде аппаратурного лечения (т.е. через пятнадцать месяцев после фиксации брекетов). Полученные результаты исследования позволяют рекомендовать выделение этих периодов как «критических», требующих проведения иммунокоррегирующей терапии и назначение средств профилактики кариеса зубов. ...

07 01 2021 22:10:44

МИКОПЕЙЗАЖ КОЖИ РАБОЧИХ МУКОМОЛЬНОГО ПРОИЗВОДСТВА

Статья в формате PDF 108 KB...

05 01 2021 2:18:17

Системный анализ онтогенеза надпочечников человека

Статья в формате PDF 102 KB...

30 12 2020 7:59:36

ЭКОЛОГИЧЕСКАЯ ПАУЗА ЧЕЛОВЕЧЕСТВА

Статья в формате PDF 157 KB...

27 12 2020 12:36:15

О НЕКОТОРЫХ ПРОБЛЕМАХ МОЛОДОЙ КАРЕЛЬСКОЙ ПИСЬМЕННОСТИ

Статья посвящена проблемам становления новейшей лексики и орфографии новописьменного карельского языка. В статье отражены современные процессы развития лексикона, а также представлена к решению проблема так называемых послеложных падежей (элатива, аблатива, комитатива, аппроксиматива и терминатива). ...

23 12 2020 22:29:29

ЛИЧНОСТНО – ОРИЕНТИРОВАННОЕ ОБУЧЕНИЕ – РАЗВИВАЮЩИЙ ПОТЕНЦИАЛ ЕСТЕСТВЕННО – НАУЧНОГО ОБРАЗОВАНИЯ

Личностно – ориентированная технология ставит в центр образовательной системы личность, которая стремится к максимальной реализации своих возможностей. Основными понятиями в личностно – ориентированном учении является обучение и развитие ученика в процессе педагогики сотрудничества. ...

19 12 2020 0:26:55

О СОЗДАНИИ ВЕТРОЭЛЕКТРИЧЕСКИХ СТАНЦИЙ В БЕЛАРУСИ

Статья в формате PDF 122 KB...

16 12 2020 9:29:11

НООСФЕРНОЕ ОБРАЗОВАНИЕ – ОТ ПРОШЛОГО К БУДУЩЕМУ

Статья в формате PDF 119 KB...

14 12 2020 3:15:12

БИОДИНАМИКА ПРЫЖКОВ В ВЫСОТУ

Статья в формате PDF 657 KB...

09 12 2020 14:35:53

БОЛЕЗНИ ПЕРВИЧНОГО ИММУНОДЕФИЦИТА У ВЗРОСЛЫХ

Статья в формате PDF 98 KB...

02 12 2020 16:55:15

АНОРОГЕННЫЕ ГРАНИТОИДЫ АБАЙСКОГО МАССИВА ГОРНОГО АЛТАЯ: ПЕТРОЛОГИЯ И ГЕОХИМИЯ

В статье приведены спорные данные предшественников по составу и особенностям становления гранитоидов Абайского массива среднего девона. Новые данные, полученные авторами по петрологии и геохимии, позволяют отнести гранитоиды массива к анорогенному типу ( А-тип) с щелочными минералами (рибекитом, астрофиллитом). Формирование массива протекало в три фазы: 1 – гранодиориты; 2 – граниты, умеренно-щелочные рибекитовые граниты; 3 – лейкограниты и лейкогранит-порфиры. Генерация их происходила в постколлизионной обстановке, инициированной плюмтектоникой. В северо-западной части массива в районе пологого погружения кровли, осложнённой куполовидным поднятием, зафиксировано аномальное обогащение флюидной магматогенной фазы летучими компонентами, и особенно фтором, что указывает на возможность обнаружения здесь редкометалльно-редкоземельного оруденения. ...

01 12 2020 9:15:58

Приметы как формы национальной культуры

Статья в формате PDF 249 KB...

30 11 2020 10:54:39

РОЛЬ РЕГУЛЯТОРНЫХ ПЕПТИДОВ В МЕХАНИЗМАХ ПОВРЕЖДЕНИЯ ЦЕНТРАЛЬНОЙ НЕРВНОЙ СИСТЕМЫ ПРИ ЭНДОТОКСЕМИИ

Патогенез грамотрицательного септического шока рассматривается с позиций нового класса пептидов - цитокинов, инициирующих и опосредующих токсичность молекулы липополисахарида. В механизмах церебральных расстройств при септицемии цитокины считаются ключевыми медиаторами, т.к. головной мозг, наряду с другими органами, является местом активного их синтеза. Считается, что основа будущих неврологических расстройств при эндотоксемии в эксперименте и клинике формируется вначале на молекулярном уровне и затем проявляется в виде морфологического субстрата на ультраструктурном уровне. При неблагоприятном стечении обстоятельств прогрессирование процесса может привести к развитию клинической картины острой церебральной недостаточности или шокового мозга. ...

29 11 2020 15:31:59

НОВЫЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ МОДЕЛИ ЭПИЛЕПСИИ

Статья в формате PDF 133 KB...

27 11 2020 21:33:20

АЛЕКСАНДР НАЗАРОВИЧ БЕЛЯЕВ

Статья в формате PDF 392 KB...

22 11 2020 22:40:48

ИКСОДОВЫЕ КЛЕЩИ И ЖИВОТНОВОДСТВО КУЗБАССА

Статья в формате PDF 117 KB...

20 11 2020 3:14:52

ОЦЕНКА ТЕПЛОВОГО СОСТОЯНИЯ НАРУШЕННЫХ ЛАНДШАФТОВ ПРИ ВОССТАНОВЛЕНИИ РАСТИТЕЛЬНОСТИ

Проанализированы изменения теплового состояния грунтов при техногенных воздействиях. Выявлено значительное повышение среднегодовой температуры верхних горизонтов криолитозоны и увеличение глубины сезонного протаивания при вырубке леса и удалении напочвенного покрова, вырубке леса на гарях в межаласном типе местности. Количественно оценена динамика среднегодовой температуры грунтов на разнорежимных вырубках, на гарях в зависимости от стадий сукцессионного развития растительности. ...

18 11 2020 12:45:49

Еще:
Обзоры -1 :: Обзоры -2 :: Обзоры -3 :: Обзоры -4 :: Обзоры -5 :: Обзоры -6 :: Обзоры -7 :: Обзоры -8 :: Обзоры -9 :: Обзоры -10 :: Обзоры -11 ::

Последовательность подготовки научной работы может быть такой:

Выбор темы. Это важный этап. Во-первых, тема должна быть интересна не только вам, но и большинству слушателей, которым вы будете её докладывать, чтобы вы видели заинтересованность в их глазах, а не откровенную скуку.

Выбор целей и задач своей научной работы. То есть, нужно сузить тему. Например, тема: «Грудное вскармливание», сужение темы: «Грудное вскармливание среди студенток нашего ВУЗа». И если общая тема мало кому интересна, то суженная до рамок собственного института или университета, она становится интересной практически для всех слушателей. Целью может стать: «Содействие оптимальным условиям вскармливания грудью детей студентов нашего ВУЗа», а задачей — доказать, что специальные условия, созданные для кормящих студенток, не помешают их успеваемости, но уменьшат количество пропусков, академических отпусков и способствуют выращиванию здоровых детей — нашего будущего. Понятно, что эта тема подходит для студентов медицинских и педагогических ВУЗов, но и в других учебных учреждениях можно найти темы, интересные всем.

Разработать методы исследования и сбора информации. В случае с естественным вскармливанием, скорее всего, это будет анкетирование студенток, имеющих детей.

Систематизировать материал и подготовить презентацию.

Подготовиться к выступлению.

Выступить и получить: награду, удовольствие и опыт, чтобы в следующем году выступить ещё лучше и сорвать шквал аплодисментов, стать узнаваемым, а значит — более конкурентоспособным!