IT-Reviews    

РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ

Рзаева А.Ш. Впервые было изучено интерлейкина – 8 – 251 ТА среди женщин Азербайджана больными эндометриозом. 50 практически здоровых и 70 женщин больных эндомертиозом находились под нашем наблюдением. Исследование показали что, генетический полиморизм интерлейкина – 8 А/Т 251 играет роль в потогенезе эндометриоза. Статья в формате PDF 236 KB эндометриозинтерлейкина – 8генетический полиморизм

Эндометриоз дисгормоналное, иммунозависимое и генетически обусловленное заболевания с доброкачественным разрастанием ткани, сходной по морфологическому строению и функции с эндометрием, но находящейся за пределами матки [1].

Больные с различными формами этой патологии страдают стойким болевым синдромом, нарушениями менструального цикла, дисфункциональными маточными кровотечениями и подвергаются многократным лечебно - диагностическим выскабливанием матки, оперативным вмешательствам, нередко бесполезным терапевтическим воздействием. [3]

Тазовая боль и вегетативно-сосудистые нарушения заставляют этих женщин обращаться ко многим специалистам, в том числе к психиатрам и психоневрологам.

Частота заболевания у женщин репродуктивного возраста, по данным различных авторов варьирует от 7 до 50 %, причем в последние годы отмечается неуклонный рост данной патологии [9, 10, 11]. Установлено что 30-40 % больных эндометриозом страдают бесплодием и невынашиванием беременности. Не менее чем у 78 % больных, получивших медикаментозную терапию по поводу эндометриоза отмечается персистенция заболевания и его рецидивы. [2]

Не смотря на значительное увеличение числа научных и клинических исследований, посвященных различным аспектам эндометриоза, многие вопросы его этиопатогенеза, диагностики, течение и терапии остаются спорными.

В настоящее время считается доказанным, что выживание и имплантация жизнеспособных фрагментов эндометрия в перитонеальной поверхности обусловлены нарушениям локального иммунного ответа.

У женщин страдающих эндометриозом увеличено содержание перитонеалных макрофагов, усилена их активность и секреция ими различных цитокинов. В последние годы было доказано что в организме женщин больных эндометриозом повышается содержание провоспалительного цитокина интерлейкина - 8 [4, 5, 6,].

Выявлено что за продукцию ИЛ-8 отвечает 13q-21q регион 4-й хромосомы. Генетический полиморфизм ТА в - 251 участке повышает продукцию ИЛ-8 [7, 8].

В Азербайджанской популяции изучению генетической зависимости эндометриоза способствует этническая однородность популяции, высокая частота данного заболевания среди женщин репродуктивного возраста, в связи с чем значительный научный интерес представляют исследования по изучению полиморфизма гена отвечающего за экспрессию интерлейкина - 8.

Целю нашего исследования разработать методы прогнозирования и ранней диагностики эндометриоза по данным полиморфизмов гена ИЛ-8 среди женщин Азербайджанской популяции.

Материалы и методы исследования

Под нашим наблюдением находилась 70 больных страдающих эндометриозом. Диагноз быль подтвержден после операционного вмешательство. Больные были в возрасте от 15 до 56 лет. Длительность заболевания колебалось от нескольких месяцев до 6 лет.

Наряду с общеклиническим обследованием больным было проведено комплексное инструментальное исследование с использованием гистероскопии, гистеросальпингографии, эхографии. Также у всех больных было проведено генетическая тестирование на определения полиморфизма ИЛ-8-251 - АТ.

Контрольную группу составили 50 практически здоровых женщин.

Для выявления полиморфизма ИЛ-8-251-ТА было использовано метод PCR-ARMS.

Участок для амплификации быль выбран на основании материалов предоставленных NCBİ SNP под номером rs4073:

F1, 5′ - GTTATCTAGAAATAAAAAAGCATACAA - 3′;

R1, 5′ - CTCATCTTTTCATTATGTCAGAG - 3′;

F2, 5′ - CATGATAGCATCTGTAATTAACTG - 3′;

R2, 5′ - CACAATTTGGTGAATTATCAA - 3′.

Для проведения реакции были использованы следующие реагенты:

DNT-5μl; Buffer 2,5μ; MgCl2-1,75μl; dNTP-0,5μl, из каждого примера 10 pmol; Taq A - 0,2μl.

Реакция PCR было проведено по следующему протоколу:

94 ºC - 5 мин - 1 цикл, 94 ºC - 30 мин, 54 ºC - 30 с, 72 ºC - 30 с, 35 цикл и 72 ºC - 7 мин - 1 цикл.

Полученные материалы были визуализированы после электрофореза в 2 % - ном агорозном геле.

Результаты исследования

Генотипы по полиморфизму ИЛ-8 ТА представлен в табл. 1.

У женщин с эндометриозом генотип ТТ составила 41,4 %. В контрольной группе генотип АА составило 50 % в то время как этот генотип в основной группе составило 21,4 %.

Таблица 1

Распостраненность генотипов ИЛ-8 ТА среди практически здоровых женщин
и больных эндометриозом 

Генотипы

Контроль (n = 50)

Эндометриоз (n = 70)

TT

7 (14 %)

29 (41,4 %)

TA

18 (36 %)

26 (37,2 %)

AA

25 (50 %)

15 (21,4 %)

Популяция было в пределах равновесия по закону Харди - Вайнберга. p > 0,05

Также эти группы отличались друг от друга по аллелным показателям.

Так как, у женщин страдающих эндометриозом частота алела Т составило 60 %. Этот показатель был выше, чем в контрольной группе. В контрольной группе частота аллела А составило 68 % в то время как частота алела Т было всего 32 %.

Нами было выявлено связь между генотипом Т/Т и эндометриозом. Частота генотипа Т/Т у женщин страдающих эндометриозом было в два раза выше чем в контрольной группе.

Генетическое тестирования женщин повышенного риска развитие эндометриоза представляет важный как теоретический, так и практический интерес. Выявления полиморфизма гена ИЛ-8 позволит на доклиническом этапе определить возможный риск развитие эндометриоза и заблаговременно начать индивидуальную профилактику этого заболевания.

Таблица 2

Частота аллелов по полиморфизму ИЛ-8 - 251 АТ среди женщин
с эндометриозом и в контрольной группе 

Аллели

Контроль (n = 100)

Эндометриоз (n = 140)

T

32 (32 %)

84 (60 %)

A

68 (68 %)

56 (40 %)

 Список литературы

  1. Кулаков В.И., Андреева Е.Н. Эндометриозы. - М.: Медицина, 2006. - 410 с.
  2. Поморцев А.В., Гудков В.Г., Дегтярев А.М. Гормональный профиль больных наружным генитальным эндометриозом в различные фазы менструального цикла // Акуш. и гин. - 2002. - №1 - С. 35-42.
  3. Сидорова И.С., Коган К.А. Новый взгляд на природу эндометриоза // Акуш. и гин. - 2002. - № 3. - С. 32-37.
  4. Halme J., Becker S., Haskill S. Altered maturation and functional of peritoneal macrophages: possible role in pathogenesis of endometriosis // J. Obstet.Gynecol. - 1987. - P. 783-789.
  5. Hill J. A. et al. Effects of soluble products of activated macrophages on human sperm motion parameters // J. Fertil. Steril. - 1987. - №47. - P. 460-465.
  6. Halme J. Release of tumor necrosis fector by human peritoneal macrophages in vivo and in vitro // J. Obst. And Gynecol. - 1989. -№161. - P. 1718-1725.
  7. Hull J. Thomson A, Kviatkovski D. Assocation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families // J. Thorax. - 2000. - v. 55. - P. 1023-1027.
  8. Junko Fujihara, kuninori Shiwaku, Toshihiro Yasuda et all. Variation of interleukin -8 - 251 AT polymorphism in worldwide populations and intra-ethnic differences in Japanese populations. // Clinica Chimica Acta 337. - 2007. - P. 79-82.
  9. Karen Kinkel, Kathrin A. Frei. Diagnosis of endometriosis with imaging: a review. Eur. Radiol. - 2006. internet.
  10. Schindler A.E. Pathophysiology, diaqnosis and treatment of endometriosis // Minevra Ginecol. - P. 419-435.
  11. Vigano P, Parazzini F, Somigliana E. // Endometriosis: epidemiology and aetiological factors // J. Obstet. And Gynaecol. - 2004. - №18. - P. 177-200.



c78089d0

Отзывы (через Facebook):

Оставить отзыв с помощью аккаунта FaceBook:

CHYTRIDIOMYCOSIS У ЛИЧИНОК RANA ARVALIS NILSSON НА СРЕДНЕМ УРАЛЕ

На основании диагностических признаков приводятся доказательства, указывающие на то, что Chytridiomycosis существует в популяциях Rana arvalis на Среднем Урале. Показана методика обнаружения заболевания по аномалиям ротового аппарата личинок и отслеживания динамики частоты встречаемости его в популяции. В экстремальных условиях инфекция поражает ослабленных и ведет к их выбраковке, что приводит к ускорению адаптации популяции в целом в быстро изменяемой среде. ...

21 01 2020 5:35:55

ЭКСПЕРТНО-ОБУЧАЮЩИЕ СИСТЕМЫ В ОБРАЗОВАНИИ

Статья в формате PDF 310 KB...

20 01 2020 10:42:12

ИЗМЕНЕНИЯ МИКРОФЛОРЫ У БОЛЬНЫХ, ОПЕРИРОВАННЫХ НА ПОВРЕЖДЕННОЙ СЕЛЕЗЕНКЕ

Проведено изучение состояние микрофлоры у пациентов после различных операций, выполненных по поводу повреждений селезенки в отдаленном послеоперационном периоде. В результате проведенного исследования установлено, что сохранение селезенки предотвращает изменения микрофлоры, так как полученные результаты соответствовали данным группы сравнения. В тоже время, удаление селезенки приводит к нарушению микрофлоры. ...

19 01 2020 14:38:42

О ПАМЯТНИКЕ ПРИРОДЫ «КАРАКАНСКИЙ ХРЕБЕТ» В КУЗБАССЕ

Статья в формате PDF 116 KB...

16 01 2020 19:25:11

ПРОБЛЕМА ПОЛУЧЕНИЯ ВЫСОКОКАЧЕСТВЕННОГО ФАРФОРА

Статья в формате PDF 113 KB...

12 01 2020 13:49:59

СОВРЕМЕННЫЕ ПРЕДСТАВЛЕНИЯ О ВОЗМОЖНЫХ МЕХАНИЗМАХ СРЫВА ИММУНОЛОГИЧЕСКОЙ ТОЛЕРАНТНОСТИ МАТЕРИ ПО ОТНОШЕНИЮ К АНТИГЕНАМ ПЛОДА КАК ВЕДУЩЕГО ФАКТОРА ИММУНОАЛЛЕРГИЧЕСКОГО ПРОИСХОЖДЕНИЯ ГЕСТОЗА. СООБЩЕНИЕ 2. О РОЛИ НАРУШЕНИЯ ПРОДУКЦИИ ПЛАЦЕНТОЙ ИММУНОСУПРЕССИР

В обзоре изложены современные представления об этиологии и патогенезе гестоза. Показано значение как генетически детерминированного, так и обусловленного развитием воспалительного процесса гениталий повышения проницаемости маточно-плацентарного барьера для антигенов плода. Рассмотрена роль иммунокомплексной патологии как пускового механизма в развитии гестоза, значение нарушения продукции плацентой белков беременности и цитокинов с иммуносупрессивным действием при осложненном течении беременности. ...

08 01 2020 10:53:29

ОПТИМИЗАЦИЯ UTRA АЛГОРИТМА МЯГКОГО ХЭНДОВЕРА СЕТИ WCDMA

Статья в формате PDF 221 KB...

03 01 2020 12:51:19

КАПСУЛИРОВАНИЕ МНОГОВЫВОДНЫХ BGA МИКРОСХЕМ

Статья в формате PDF 135 KB...

01 01 2020 7:22:12

ИССЛЕДОВАНИЕ КАЧЕСТВА СТИРКИ НА ОСНОВЕ ВЛИЯНИЯ ПАВ

Статья в формате PDF 106 KB...

22 12 2019 17:44:31

Право и долг в самосознании русского народа

Статья в формате PDF 113 KB...

16 12 2019 13:59:10

ОСНОВНЫЕ ПРИНЦИПЫ ДИАГНОСТИКИ РАБОТОСПОСОБНОСТИ БОРТОВОЙ АППАРАТУРЫ АВТОМАТИЧЕСКИХ КА И ВЫРАБОТКИ РЕКОМЕНДАЦИЙ ПО УСТРАНЕНИЮ НЕШТАТНЫХ СИТУАЦИЙ

При управлении автоматическими космическими аппаратами ( К А) важной проблемой является обеспечение надежного и оперативного анализа и диагностирования работоспособности бортовых систем. Это позволит своевременно выявить негативные тенденции в работе бортовой аппаратуры и предотвратить их развитие. Наибольшую актуальность проблема приобретает при управлении К А со сложными бортовыми системами, характеризующимися большим объемом телеметрических параметров, а так же при необходимости выдачи командных воздействий непосредственно в сеансах связи. Существующий опыт управления К А показывает, что в ряде случаев только своевременная выдача команд немедленного исполнения позволила обеспечить выполнение программы полета К А [1]. В настоящей работе предлагается общий подход к решению указанной проблемы, основанный на создании адекватных моделей анализа и диагностики функционирования бортовых систем и алгоритмов автоматизированной выработки рекомендаций по воздействию на К А. Ожидается, что использование в практике управления таких моделей и алгоритмов даст возможность существенно повысить эффективность работы аппаратуры, в том числе за счет оперативного устранения возникающих на борту нештатных ситуаций. ...

15 12 2019 12:38:54

ИЗУЧЕНИЕ УСЛОВИЙ ПОЛУЧЕНИЯ ФИЦИН-СОДЕРЖАЩЕГО СЫРЬЯ

Статья в формате PDF 124 KB...

14 12 2019 11:19:58

НАЧАЛЬНЫЕ ЭТАПЫ ФОРМИРОВАНИЯ ЛЕВОГО ЯРЕМНОГО ЛИМФАТИЧЕСКОГО СТВОЛА У ПЛОДОВ ЧЕЛОВЕКА

У плодов человека 10-12 нед обнаружено формирование левых яремных лимфатических стволов. Медиальный ствол спускается к грудному протоку около трахеи и пищевода. Поперечный латеральный ствол выходит из воротного синуса крупного нижнего глубокого латерального шейного лимфатического узла, расположенного на месте медиального отрога яремного лимфатического мешка, проходит позади блуждающего нерва и общей сонной артерии и впадает в начало шейной части грудного протока. ...

13 12 2019 9:39:28

ОСОБЕННОСТИ ПСИХОФИЗИОЛОГИИ В ВЫСШЕЙ ШКОЛЕ

Целью данной работы был анализ психофизиологических показателей студентов очной формы обучения, разработка мер по оптимизации учебного процесса и по предотвращению развития хронического стресса. Испытуемыми были 62 студента Института декоративно-прикладного искусства (средний возраст 25±3,7 лет) и 24 студента других высших учебных заведений, занимающихся в группе Айкидо (средний возраст 20,5±2,2 лет). Психофизиологическое состояние здоровья студентов расценивается как «функциональное перенапряжение». знание психофизиологических механизмов восприятия улучшает усвоение нового лекционного непрофильного материала. занятия восточными спортивными практиками способствуют нормализации исследуемых функций ...

10 12 2019 7:37:18

ИСПОЛЬЗОВАНИЕ МЕТОДА ПРОЕКТОВ В ЛИЦЕЕ ПРИ ВУЗЕ

Статья в формате PDF 97 KB...

09 12 2019 19:15:24

МАКРО-РЕЧЕВЫЕ АКТЫ КОРПОРАТИВНОГО ДИСКУРСА

Статья в формате PDF 224 KB...

07 12 2019 21:50:50

ПУТИ ИСПОЛЬЗОВАНИЯ СЕМЯН ОБЛЕПИХИ НА ПИЩЕВЫЕ ЦЕЛИ

Статья в формате PDF 100 KB...

28 11 2019 21:44:50

ЭМОТИВНЫЙ КОНЦЕПТ «ОБИДА» В ХУДОЖЕСТВЕННОМ ПРОСТРАНСТВЕ

В статье на основе материала « Национального корпуса русского языка» дан анализ вербальному и невербальному воплощению эмотивного концепта «обида» в художественном тексте. На языковом уровне рассмотрена сочетаемость лексемы «обида» с другими словами-эмотивами. На неязыковом уровне охарактеризованы невербальные компоненты проявления данной эмоции (плач, взгляд, жесты). Представленный анализ позволяет сделать вывод о национальной специфики данного чувства. ...

25 11 2019 16:29:30

ФОРМАЛИЗАЦИЯ ВЛИЯНИЯ ВНЕШНИХ СВЯЗЕЙ НА КАЧЕСТВО ОБРАЗОВАНИЯ В ФИЛИАЛЕ ВУЗА

Построена математическая модель системы управления качеством образования филиала В У За с учетом влияния внешних информационных связей, проведена оценка критерия качества и улучшения внешних связей вследствие внедрения информационной системы. ...

20 11 2019 5:30:11

ТРАНСНАЦИОНАЛИЗАЦИЯ РОССИЙСКОГО БИЗНЕСА

Статья в формате PDF 320 KB...

17 11 2019 15:14:29

АНАЛИЗ ГИДРОГЕОХИМИЧЕСКОЙ ИНФОРМАЦИИ

Статья в формате PDF 140 KB...

13 11 2019 18:30:26

ФИЛОСОФСКИЕ ОСНОВАНИЯ ОБЩЕЙ ТЕОРИИ ПАТОЛОГИИ: ПРИНЦИП ПОДОБИЯ

В основе современной научной теории патологии должны лежать фундаментальные философские принципы бытия материи, из которых выводятся и обосновываются ее основные положения. В данной работе проведен анализ принципа подобия как частного выражения философского принципа субстанциального единства мира. Делается вывод, что один общий биологический процесс лежит в основе как нормальных, так и патологических явлений: приспособление есть сущность болезни. ...

11 11 2019 12:54:46

РОЛЬ АУДИТОРИИ В УЧЕБНОМ ПРОЦЕССЕ

Статья в формате PDF 108 KB...

10 11 2019 3:44:50

АНАЛИЗ ТЕПЛОВОГО РАЗГОНА В АККУМУЛЯТОРАХ НКБН-25-У3

Статья в формате PDF 121 KB...

09 11 2019 1:53:36

ОТ РЕВОЛЮЦИЙ К ЗДОРОВОМУ СНОБИЗМУ

Статья в формате PDF 135 KB...

02 11 2019 20:18:49

СЕЗОННЫЕ ФАКТОРЫ В РОЖДЕНИИ БОЛЬНЫХ ШИЗОФРЕНИЕЙ

Обсуждается сезонность рождения больных шизофренией. Исследовав 2017 случаев заболевания, авторы отмечают сезонность и гендерные различия в рождении больных шизофренией. Высказывается предположение, что одной из причин сезонных колебаний рождаемости больных, у мужчин, может быть патогенное действие вирусной инфекции на головной мозг плода во втором триместре беременности. ...

31 10 2019 3:50:24

МАГНИТНЫЕ ПОДРЕШЕТКИ, ИНДУЦИРОВАННЫЕ КАТИОННЫМИ ВАКАНСИЯМИ (НА ПРИМЕРЕ ФЕРРИМАГНИТНОГО ПИРРОТИНА)

На основе анализа s-d обменного взаимодействия в структурах типа NiAs с частично вакантными катионными позициями, моделировались различного рода зависимости результирующей намагниченности от температуры нестехиометрических ферримагнетиков. На основе исследований пирротина методами Я Г Р и Р Ф А доказано, что двухподрешеточный ферримагнетик, содержащий в структуре катионные вакансии, должен рассматриваться, при определенном типе распределения вакансий, как ферримагнетик с четырьмя магнитными подрешетками. В данном случае, дополнительные магнитные подрешетки можно рассматривать как подрешетки, индуцированные характером распределения катионных вакансий в структуре. Квантово-механические расчеты в рамках модели молекулярного поля температурных изменений намагниченности отдельно для каждой из подрешеток, а также анализ результирующей термокривой намагниченности, объясняют ряд экспериментально полученных кривых зависимости намагниченности от температуры нестехиометрического пирротина с различной плотностью вакансий в структуре. ...

29 10 2019 21:39:19

ЗДОРОВЬЕ ДЕТЕЙ ЛИЦ, ПЕРЕБОЛЕВШИХ ХЛОРАКНЕ

Статья в формате PDF 109 KB...

25 10 2019 9:21:26

Клиника и лечение кишечного амебиаза

Статья в формате PDF 104 KB...

24 10 2019 21:40:33

ОСОБЕННОСТИ ПОДГОТОВЛЕННОСТИ СПОРТСМЕНОК ДЛЯ ДАЛЬНЕЙШЕЙ СПЕЦИАЛИЗАЦИИ НА ОЛИМПИЙСКОЙ ДИСТАНЦИИ

В статье отражены результаты комплексного исследования подготовленности спортсменок, специализирующихся в беге на 300-400 м с барьерами. Дан анализ статистически достоверных различий по педагогическим, физиологическим и биометрическим показателям в ответственейший момент спортивной карьеры - момент перехода с «детской» дистанции (бега на 300 м с барьерами) на олимпийскую дисциплину (400 м с барьерами). Выявлены взаимосвязи между различными сторонами подготовленности: физической, функциональной и технической. Представленный материал можно использовать в виде модельных характеристик для девушек в возрасте 15-16 лет и закономерностей становления спортивного мастерства при уточнении Учебной программы для детско-юношеских спортивных школ, специализированных детско-юношеских школ олимпийского резерва и школ высшего спортивного мастерства по разделу « Барьерный бег». ...

22 10 2019 8:44:30

ФОРМИРОВАНИЕ СОВРЕМЕННОЙ ИНТЕЛЛИГЕНЦИИ В УСЛОВИЯХ СТАНОВЛЕНИЯ ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ

В настоящее время одной из наиболее обсуждаемых является тема воздействия интеллигенции на общественно-экономическую жизнь. Интеллигенция, являясь наиболее образованной группой общества, является монополистом в области на духовного и интеллектуального производства. По мере ускорения научно-технического прогресса данная тенденция усиливается. ...

21 10 2019 0:47:42

СИДОРОВА КЛАВДИЯ АЛЕКСАНДРОВНА

Статья в формате PDF 167 KB...

20 10 2019 17:31:15

ЭТИКА НОВОГО ТЫСЯЧЕЛЕТИЯ

Статья в формате PDF 211 KB...

17 10 2019 7:53:25

ИССЛЕДОВАНИЕ СВОЙСТВ АСПИРАЦИОННОЙ ПЫЛИ

Статья в формате PDF 255 KB...

15 10 2019 10:43:51

СИМФОНИЯ УРОКА

Статья в формате PDF 142 KB...

09 10 2019 0:29:38

РАЦИОНАЛЬНОЕ НЕДРОПОЛЬЗОВАНИЕ – ПУТЬ К ПРОЦВЕТАНИЮ

Статья в формате PDF 213 KB...

07 10 2019 15:47:44

МЕЖДУНАРОДНЫЙ КОНГРЕСС «ПРАКТИКУЮЩИЙ ВРАЧ»

Статья в формате PDF 251 KB...

05 10 2019 22:54:25

ПСИХОСОМАТИЧЕСКИЙ ПОДХОД В ГЕРОНТОПСИХИАТРИИ

Статья в формате PDF 95 KB...

03 10 2019 12:24:24

PROBLEMS OF BIOCHEMICAL INDICATION OF STATUS OF FISHES OF NORTH BASIN

Статья в формате PDF 127 KB...

15 09 2019 7:54:56

ХЛОР КАК ТОКСИЧЕСКИЙ АГЕНТ

Статья в формате PDF 256 KB...

10 09 2019 8:59:17

КОРЯК ЮРИЙ АНДРЕЕВИЧ

Статья в формате PDF 358 KB...

05 09 2019 21:25:35

К ТЕОРИИ ВИНТОВОГО ПРЕОБРАЗОВАТЕЛЯ СИЛ

Статья в формате PDF 376 KB...

03 09 2019 20:30:32

ЛИЧНОСТНО – ОРИЕНТИРОВАННОЕ ОБУЧЕНИЕ – РАЗВИВАЮЩИЙ ПОТЕНЦИАЛ ЕСТЕСТВЕННО – НАУЧНОГО ОБРАЗОВАНИЯ

Личностно – ориентированная технология ставит в центр образовательной системы личность, которая стремится к максимальной реализации своих возможностей. Основными понятиями в личностно – ориентированном учении является обучение и развитие ученика в процессе педагогики сотрудничества. ...

28 08 2019 1:30:52

УЧЕНИЕ В.И. ВЕРНАДСКОГО И ЗДОРОВЬЕ НАСЕЛЕНИЯ

Статья в формате PDF 89 KB...

27 08 2019 13:31:48

Еще:
Обзоры -1 :: Обзоры -2 :: Обзоры -3 :: Обзоры -4 :: Обзоры -5 :: Обзоры -6 :: Обзоры -7 :: Обзоры -8 :: Обзоры -9 :: Обзоры -10 :: Обзоры -11 ::

Последовательность подготовки научной работы может быть такой:

Выбор темы. Это важный этап. Во-первых, тема должна быть интересна не только вам, но и большинству слушателей, которым вы будете её докладывать, чтобы вы видели заинтересованность в их глазах, а не откровенную скуку.

Выбор целей и задач своей научной работы. То есть, нужно сузить тему. Например, тема: «Грудное вскармливание», сужение темы: «Грудное вскармливание среди студенток нашего ВУЗа». И если общая тема мало кому интересна, то суженная до рамок собственного института или университета, она становится интересной практически для всех слушателей. Целью может стать: «Содействие оптимальным условиям вскармливания грудью детей студентов нашего ВУЗа», а задачей — доказать, что специальные условия, созданные для кормящих студенток, не помешают их успеваемости, но уменьшат количество пропусков, академических отпусков и способствуют выращиванию здоровых детей — нашего будущего. Понятно, что эта тема подходит для студентов медицинских и педагогических ВУЗов, но и в других учебных учреждениях можно найти темы, интересные всем.

Разработать методы исследования и сбора информации. В случае с естественным вскармливанием, скорее всего, это будет анкетирование студенток, имеющих детей.

Систематизировать материал и подготовить презентацию.

Подготовиться к выступлению.

Выступить и получить: награду, удовольствие и опыт, чтобы в следующем году выступить ещё лучше и сорвать шквал аплодисментов, стать узнаваемым, а значит — более конкурентоспособным!